lt span lang 3dnl style 3d apos font size 14 0pt mso ansi language nl apos gt he said he had bo ught a new motorbike for himself the day before

Báo cáo y học: " The sequence of the CA-SP1 junction accounts for the differential sensitivity of HIV-1 and SIV to the small molecule maturation inhibitor 3-O-{3'''',3''''-"</h1> <p style="font-size:11px;margin-bottom:3px;">Chia sẻ: <a href="http://tailie

Báo cáo y học: " The sequence of the CA-SP1 junction accounts for the differential sensitivity of HIV-1 and SIV to the small molecule maturation inhibitor 3-O-{3'''',3''''-"</h1> <p style="font-size:11px;margin-bottom:3px;">Chia sẻ: <a href="http://tailie

Ngày tải lên : 13/08/2014, 13:20
... were: GAAGGCTCGAGTACTGGCAGAAGCCATGAAAGAG (sense) and TGGCTTCTGCCAGTACTCGAGCCTTTC (antisense) The PCR products were cleaved with BamHI and SbfI and used to replace the corresponding fragment in ... compound acts at a late stage of the HIV-1 replication cycle and results in the accumulation of an intermediate in the processing of Pr55Gag due to delayed cleavage at the CA-SP1 junction Although ... unexpected, as the sequence of the CA-SP1 junction is highly conserved among HIV-1 isolates, and changes in the proximal half of the cleavage site could also affect the function of the CA protein DSB acts...
  • 10
  • 194
  • 0
Tài liệu Vẽ ghế xoay với 3D Max 5 Phần 14 docx

Tài liệu Vẽ ghế xoay với 3D Max 5 Phần 14 docx

Ngày tải lên : 25/01/2014, 11:20
... thư mục Editable Poly khung bên phải điều chỉnh lại hình dạng theo ý thích Mô hình vòng viền cao su tạo có dạng: Tiếp theo, nối mặt t a lưng với mặt ghế Trong khung hiển thị Left Viewport, vẽ đường ... chuyển đường viền theo hướng trục Z tạo nên kiểu đường viền Thực thao tác tương tự công cụ Scale Tool nhấn phím Shift cho đường viền Nếu muốn chọn đối tượng khác nhánh thư mục Editable Poly khung ... đường thẳng hình: Chọn lại khung hiển thị Front Viewport di chuyển đường thẳng v a vẽ lên đối tượng cần nối Bo tròn góc đường thẳng vị trí hình: Trong khung hiển thị bất kỳ, chọn đối tượng Spline...
  • 10
  • 331
  • 0
Báo cáo "Development of a software package for 3D structured mesh generation " pdf

Báo cáo "Development of a software package for 3D structured mesh generation " pdf

Ngày tải lên : 14/03/2014, 13:20
... an one to one inverse mapping between the 3D real computational domain and a rectangular domain in the parametric space [1, 2, 5, 6] For short, the formulae for Y and Z coordinates are the same ... the conic and the sinusoidal objects (as mentioned in the sections above) that the density of the mesh points close to the real area has to be greater than that afar Fig 21 The 3D computational ... desirable that the mesh in the area where the contour lines are close to each other, i.e big slope, is finer than the mesh in the area where the contour lines are far from each other, i.e small...
  • 14
  • 402
  • 0
LUẬN VĂN QUAN HỆ HAI BỜ DƯỚI LĂNG KÍNH AN NINH TRUYỀN THỐNG pdf

LUẬN VĂN QUAN HỆ HAI BỜ DƯỚI LĂNG KÍNH AN NINH TRUYỀN THỐNG pdf

Ngày tải lên : 19/03/2014, 21:20
... Burkina Faso Lesotho 1995 Gambia 1996 Niger Senegal Niger 1997 Bahamas, Saint CH Chad Sao Tome, CH Bahamas, Saint Lucia Chad Lucia 1998 Nam Phi, Nam Phi, Trung Phi, Trung Phi, GuineaGuineaBissau,Tonga ... Bahamas, Bahamas, Grenada, Grenada, Berisso, Berisso, Liberia Liberia 1990 Saudi Arabia Lesotho, Lesotho 、 Saudi Arabia Nicaragua 、 Nicaragua 、 Guinea Bissau Guinea Bissau 1991 C.H Trung Phi C.H Trung ... an ninh, tuỳ theo góc độ nhu cầu sử dụng khác nhau, người ta lại chia nhiều loại: chia theo đơn vị phạm vi, có an ninh nhân loại, an ninh khu vực, an ninh quốc gia, an ninh đường phố ; chia theo...
  • 20
  • 331
  • 0
Báo cáo hóa học: " TSaT-MUSIC: a novel algorithm for rapid and accurate ultrasonic 3D localization" pdf

Báo cáo hóa học: " TSaT-MUSIC: a novel algorithm for rapid and accurate ultrasonic 3D localization" pdf

Ngày tải lên : 20/06/2014, 22:20
... peak values of Pt(τ) in the same way as in the S-MUSIC algorithm When the bandwidth of the multicarrier waves is fd, the T-MUSIC algorithm can estimate a delay time to an accuracy of 1/fd The ... have the same amplitude, and their initial phases are given so that the transmitted wave has a peak amplitude at the half time of the transmission period (0.5 ms) The frequencies of the subcarriers ... also affect the performance of the 3D localization The other reasons for this performance deterioration in real experiments seemed related to the attenuation of the transmitted signals or multipath...
  • 8
  • 432
  • 0
Báo cáo hóa học: " 3D-SoftChip: A Novel Architecture for Next-Generation Adaptive Computing Systems" pdf

Báo cáo hóa học: " 3D-SoftChip: A Novel Architecture for Next-Generation Adaptive Computing Systems" pdf

Ngày tải lên : 22/06/2014, 23:20
... unit According to a given application program, the PE array processes large amounts of data in parallel while the ICS controls the overall system and directs the PE array execution, data, and address ... processor The ICS RISC controls the execution of the PE array and provides control and address signals to program/data memory, the data frame buffers, and the DMA controller It has a 3-stage pipelinedarchitecture ... chip is a control processor which controls the CAP chip via the IBIA as well as the overall system The ICS RISC provides control and address signals and data to the system as a whole The switch...
  • 13
  • 228
  • 0
DEFORM-3D Keyword Documentation Part 14 pps

DEFORM-3D Keyword Documentation Part 14 pps

Ngày tải lên : 11/08/2014, 02:21
... defines the heat exchange information such as temperature, convection coefficient, and the radiation view factor Applicable Simulation Modules: Thermal Applicable Simulation Modes: Heat Transfer Applicable ... specifies the heat exchange window for an object The keyword should be used if the boundary condition of heat exchange is different at a specific region than the rest of the object REMARKS The keyword ... defined as is the stress and , where is the strain It should be noted that the Young's Modulus is only valid in the elastic (or linear) region of the stress-strain diagram EXAMPLE The following example...
  • 18
  • 152
  • 0
Chỉnh sửa toàn bộ font, size các công thức bằng Mathtype

Chỉnh sửa toàn bộ font, size các công thức bằng Mathtype

Ngày tải lên : 17/12/2015, 02:03
... Nguồn tin: giaoductrangbom.com ...
  • 2
  • 1.1K
  • 3
mẫu biểu đồ powerpoint kiểu 3d, 3d style

mẫu biểu đồ powerpoint kiểu 3d, 3d style

Ngày tải lên : 12/03/2014, 16:28
... liệu % % slide.tailieu.vn TIÊU ĐỀ Nội dung số liệu xanh da trời nhạt Nội dung số liệu xanh Nội dung số liệu tím Nội dung số liệu hồng Nội dung số liệu xanh mạ Nội dung số liệu xanh biển Nội dung ... liệu xanh da trời đậm Nội dung số liệu đỏ slide.tailieu.vn LOREM IPSUM – your text NỘI DUNG Mô tả nội dung NỘI DUNG NỘI DUNG Mô tả nội dung 15 % Mô tả nội dung 30 % 85 % 70 % 50 % 50 % slide.tailieu.vn ... 12.1% slide.tailieu.vn TIÊU ĐỀ Dữ liệu Dữ liệu 12.1% Dữ liệu Dữ liệu 12.1% 12.1% 12.1% Dữ liệu Dữ liệu 12.1% Giải thích biểu đồ, số liệu, ngày tháng năm, … 12.1% 12.1% 12.1% 12.1% slide.tailieu.vn...
  • 6
  • 4.7K
  • 7
Làm tranh 3D ngôi làng kẹo ngọt tặng bé yêu pot

Làm tranh 3D ngôi làng kẹo ngọt tặng bé yêu pot

Ngày tải lên : 17/03/2014, 17:20
... nhà b a màu b a thường tô trang trí, sau dán vào ph a trước hộp Hai kẹo dán hai bên c a lớn, bạn dùng kiểu hình ô c a khác Trang trí thêm nút hạt thích Cắt gai dán thành ô nhỏ, dán n a gai dán ... hộp b a Bước 2: Phần nắp hộp gập mép hai bên dán bên vào ph a hộp, bên gài chạt vào b a vờ mái nhà Bạn làm mái nhà b a màu, b a có hoa văn b a thường có tô màu trang trí Mái nhà hộp b a trang ... mẹ làm tranh 3D làng kẹo để treo phòng! Bạn cần chuẩn bị nguyên vật liệu sau để làm tranh 3D làng kẹo ngọt: - Giấy b a - Bút màu b a màu - Kéo, keo dán, gai dán - Khung tranh dán b a sáng đẹp,...
  • 9
  • 466
  • 1
Animated Expressions: Expressive Style in 3D Computer Graphic Narrative Animation potx

Animated Expressions: Expressive Style in 3D Computer Graphic Narrative Animation potx

Ngày tải lên : 30/03/2014, 18:20
... revealing the socially coded basis of cultural phenomena which are taken -for- granted as natural Ironically, during the same period, naturalism has become the sine qua non of CG research, the achievement ... of theatre, film, musicals and opera, who has successfully adapted animation for stage,6 sees art as essentially about transformation, and argues that an artist must transform and distort reality ... seamless performance capture and 3D model generation from video, for example, are all particularly active research and development areas, and all are linked to the naturalistic agenda As the...
  • 24
  • 548
  • 0
bài 3 tạo style cho font và văn bản

bài 3 tạo style cho font và văn bản

Ngày tải lên : 23/05/2014, 16:54
... FONT THUỘC TÍNH C A FONT Fontstyle font Fontvariant Bài - Tạo style cho font văn Fontweight 12 FONT -STYLE Inherit: font chữ mang tính kế th a Italic: chữ in nghiêng font -style Normal: chữ bình thường ... văn 14 FONT- WEIGHT a {font- weight:bold;} lighter 100900 inherit Fontweight bolder normal bold Bài - Tạo style cho font văn 15 FONT- WEIGHT CSS: p {font -style: normal; font- weight:bolder} span {font -style: normal; ... Tạo style cho font văn 13 FONT -STYLE CSS p {font -style: italic;} span {font -style: normal;} XHTML: Đây văn in nghiêng với một đoạn không in nghiêng< /span> gi a. Bài - Tạo style cho font...
  • 38
  • 342
  • 0
Blend style lãng mạn 2 [Textures Blend]- P1 pps

Blend style lãng mạn 2 [Textures Blend]- P1 pps

Ngày tải lên : 08/07/2014, 05:20
... hành Sau dùng công cụ Crop Tool ( C ) để crop ảnh lại với size mong muốn, bỏ border trắng ảnh gốc Trong blend làm sáng ảnh lên trước làm bước giúp màu sau trộn tươi Và tất bước h a trộn sau sử ... h a trộn sau sử dụng cách add Adjustment Layer lên Các bạn cần click vào biểu tượng hình tròn n a trắng đen chọn tool bảng lên để h a trộn Các bạn chọn Brightness/Contrast chỉnh thôn số 10 / ... ảnh thường có chi tiết thường nguôn gốc chúng ý ngh a hình thù thường màu sắc h a trộn , ánh sáng, chất liệu, v.v Các bạn lên google deviantart.com để tìm textures) Mình chuẩn bị texture trước...
  • 5
  • 212
  • 0
Blend style lãng mạn 2 [Textures Blend]- P2 docx

Blend style lãng mạn 2 [Textures Blend]- P2 docx

Ngày tải lên : 08/07/2014, 05:20
... ra) hình copy lên layer nằm layer Brightness/Contrast Lúc hình copy lớn bé khung làm việc giao diện này,bạn chỉnh lại size hình paste sau ( Mình nói rõ tỉ mỉ điều ... theo bạn ấn Ctrl + T ( Free Transform) để điều chỉnh lại size texture vị trí Bước làm nhiều bạn muốn áp texture vào hình Sau Ctrl + T bạn để vị trí hình minh h a Click vào tool để bỏ free transform ... hình minh h a Click vào tool để bỏ free transform bạn chỉnh xong Gọi layer T1 Để layer T1 chế độ Linear Burn | Opacity 75% sau bạn dùng tẩy tròn biên mềm size khoảng 200 đến 250px Flow thấp khoản...
  • 5
  • 233
  • 0
Blend style lãng mạn 2 [Textures Blend]- P4 pptx

Blend style lãng mạn 2 [Textures Blend]- P4 pptx

Ngày tải lên : 08/07/2014, 05:20
... Và Copy , Paste vào texture gọi layer T3 chỉnh Free Transform Sau dùng tẩy size thông số tẩy ban đầu, tẩy textures chút khu vực góc bên phải chỗ mặt mod, cảm thấy lem lộn xộn, layer T3 lúc kết ... cho công đoạn texture có màu trắng đen có vết xước copy paste vào (Đặt tên layer T4)nhưng chỉnh Free Transform chỉnh chiều rộng chiều cao texture chiều cáo chiều rộng ảnh, ...
  • 5
  • 357
  • 0
Blend style lãng mạn 2 [Textures Blend]- P5 pdf

Blend style lãng mạn 2 [Textures Blend]- P5 pdf

Ngày tải lên : 08/07/2014, 05:20
... hình bạn v a làm xong vào (Ctrl + V) Dùng Move Tool kéo sang bên sau nhân đôi layer lên layer copy bạn chọn Edit / Transform / The Horizontal (quay ngược hình) dùng move tool kéo sang bên Ctrl ... chút trang trí nhỏ Các bạn nhấn tổ hợp phím Ctrl + shift + alt + E để gộp layer tạo thành layer Sau Ctrl + A (chọn hết vùng) Ctrl + C (copy) Ctrl + N tạo layer với size 777x600px sau paste hình ... ý lúc chỉnh màu lúc chèn textures phải tẩy cho không nhiều mà ko khu vực mod ! file psd : download here Chúc bạn thành công ! ...
  • 5
  • 279
  • 0