loi dich bai rhythm of the rain

Rhythm of the rain

Rhythm of the rain

Ngày tải lên : 14/12/2013, 13:51
  • 2
  • 292
  • 0
RHYTHM OF THE RAIN pptx

RHYTHM OF THE RAIN pptx

Ngày tải lên : 23/06/2014, 00:20
  • 1
  • 243
  • 0
Bài hát quan thế âm - Phạm Duy (lời bài hát có nốt)

Bài hát quan thế âm - Phạm Duy (lời bài hát có nốt)

Ngày tải lên : 07/11/2013, 22:15
... =======================& 2 4 Quaựn The Am. ô ô ô ô j Coự ô ô ô ô baứ Meù Ê ô ô ô ô ô ô ô ô ô ô ô ô ô ô ủi tỡm ằ ằ ằ ằ . con...
  • 2
  • 1.2K
  • 4
Bài giảng Chapter 7 The Quantum-Mechanical Model of the Atom

Bài giảng Chapter 7 The Quantum-Mechanical Model of the Atom

Ngày tải lên : 28/11/2013, 01:11
... measure of how intense the light is – the larger the amplitude, the brighter the light ã the wavelength, () is a measure of the distance covered by the wave  the distance from one crest to the ... proportional to the amplitude and frequency of the waves  the larger the wave amplitude, the more force it has  the more frequently the waves strike, the more total force there is Tro, Chemistry: ... Waves ã the frequency, () is the number of waves that pass a point in a given period of time  the number of waves = number of cycles  units are hertz, (Hz) or cycles/s = s -1  1 Hz = 1 s -1 ã the...
  • 79
  • 368
  • 0
Bài soạn TUYỂN TẬP 50 BÀI HÁT TIẾNG ANH (Có lời dịch)

Bài soạn TUYỂN TẬP 50 BÀI HÁT TIẾNG ANH (Có lời dịch)

Ngày tải lên : 29/11/2013, 02:12
... with all the voices of the mountains To paint with all the colors of the wind You can own the Earth and still all you'll own is earth Until you can paint with all the colors of the wind Hãy ... mà thôi. 46- Can You Feel The Love Tonight - Elton John Can You Feel The Love Tonight(Elton John) There's a calm surrender To the rush of day When the heat of the rolling world Can be turned ... to say Been lonely since the day The day you went away So sad but true For me there's only you Been crying since the day The day you went away The day you went away The day you went away Oh...
  • 54
  • 3.2K
  • 30
Tài liệu Bài thuyết trình " The Psychology of Selling: Why people buy, what people buy" ppt

Tài liệu Bài thuyết trình " The Psychology of Selling: Why people buy, what people buy" ppt

Ngày tải lên : 13/12/2013, 06:15
... Buyer Resolution Theory Five buying decisions:  Why should I buy?  What should I buy?  Where should I buy?  What is a fair price?  When should I buy? The Psychology of Selling: Why people ... stimulates behavior intended to satisfy that need.  All buying behaviors must be based on the needs, but the needs that are promoted by effective culimuti (Buying Motive), will become buying...
  • 4
  • 880
  • 2
Tài liệu TRUYỆN CỔ TÍCH ANH NGỮ ( KO CÓ BẢN DỊCH) The Princess of the Golden Island doc

Tài liệu TRUYỆN CỔ TÍCH ANH NGỮ ( KO CÓ BẢN DỊCH) The Princess of the Golden Island doc

Ngày tải lên : 20/01/2014, 23:20
... picked the poppy seeds out of the garden. They finished before the end of the hour. Then they flew away. When the hour was over, the uncle and the leaders came in. They were very surprised! The ... ants began to bite him. They were angry because the old man was in their way. Majka saw the ants biting Yust. She pushed them away so the old man could sleep. Many of the ants bit her hands, ... Majka became the queen. She ruled the happy people of the Golden Island of many, many years. ANH VĂN THIẾU NHI – TRUYỆN CỔ TÍCH ANH NGỮ ( KO CÓ BẢN DỊCH) The Princess of the Golden...
  • 4
  • 687
  • 2
Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf

Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf

Ngày tải lên : 07/03/2014, 16:20
... transcript, of 2 kb, is produced [29]. The trout IL-11 gene gives rise to a single transcript of 3.2 kb in RTS cells, as seen in the northern blot (Fig. 7), and is the largest of the known IL-11 ... differ- ences were a 26 bp insertion in the 5Â-UTR of the cDNA and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3Â-UTR of the cDNA sequence (Fig. 1). A ... in the 5Â-UTR, and four potential poly(A) signals were found in the 3Â-UTR (Fig. 1), two of them just 14 or 23 bp upstream of the poly(A) tail. The remaining two poly(A) signals were upstream of the...
  • 12
  • 511
  • 0