log in as root and open a terminal window change directory to etc init d create a copy of
báo cáo khoa học:" Circulating Immune Complexes and trace elements (Copper, Iron and Selenium) as markers in oral precancer and cancer : a randomised, controlled clinical trial" pot
Ngày tải lên :
11/08/2014, 23:22
... clinical, histological and molecular level has marked the end of an era of groping in the dark for clues to the basis of cancer Significant reduction in mortality can be achieved my advances in early ... value was 0.058) indicating that the groups are comparable on the basis of gender (Table No 1) Most of the individuals in the study were males who had tobacco, areca nut chewing and associated habits ... cell carcinomas include various carcinogens in tobacco and related products such as polynuclear aromatic hydrocarbons, and nitrosamines Alcohol, viruses, genetic mechanisms, candida, chronic Table...
- 10
- 317
- 0
Tài liệu Bike Lanes, On-Street Parking and Business: A Study of Bloor Street in Toronto’s Annex Neighbourhood docx
Ngày tải lên :
18/02/2014, 00:20
... DATA ANALYSIS Under direction of the lead researcher, the survey team entered and compiled the survey data and computed preliminary tallies and trends. Additional survey and parking data analysis and ... Parking and Business 20 totals for each of the seven study days (see Table 8. Bloor Street and Spadina Road average hourly on‐street parking usage). Table Bloor Street and Spadina Road average ... Weekday Evening Average 72% Saturday Evening 105% Weekday Average 74% Saturday 64% Weekday Evening Average 55% Saturday Evening 38% Weekday Average 60% Saturday 49% Weekday Evening Average 62% Saturday...
- 38
- 686
- 0
REPRODUCTIVE, MATERNAL AND CHILD HEALTH IN EASTERN EUROPE AND EURASIA: A COMPARATIVE REPORT ppt
Ngày tải lên :
14/03/2014, 16:20
... was technical advisor to the surveys in Romania, Moldova, Georgia, and Azerbaijan Almaz Sharman Dr Sharman is a physician and has a Ph .D in immunology He is currently the Infectious Disease Advisor ... Suggested citation: Centers for Disease Control and Prevention and ORC Macro 2003 Reproductive, Maternal and Child Health in Eastern Europe and Eurasia: A Comparative Report Atlanta, GA (USA) and Calverton, ... up -to- date and reliable information on these topics The surveys also provide data on key maternal and child health indicators, including anemia, infant feeding and nutrition, and the extent to which...
- 15
- 314
- 0
Báo cáo " Teaching efl writing in Vietnam: Problems and solutions - a discussion from the outlook of applied linguistics " doc
Ngày tải lên :
22/03/2014, 10:20
... writing in Vietnam Defining and Tackling the Problems of Teaching and Learning EFL Writing Generally, as Grabe and Kaplan [5] discuss, language teachers in a writing course should be motivated to ... since reading and writing go hand in hand Learners will be motivated to write when they obtain necessary vocabulary, grammar and writing style through reading passages Particularly, as suggested by ... [11], authentic reading texts often contain different levels of adequacy in formal linguistics, that is, observational adequacy, descriptive adequacy, and explanatory adequacy Consequently, students...
- 6
- 704
- 1
Thesis: Directness in conversations in american english and vietnamese A comparative study
Ngày tải lên :
04/07/2014, 06:12
... cocoons and spun; how (speaking even faster) the brocade was woven with gold and silver threads and then embroidered, too; and how (speaking faster still) robe was perfectly tailored to fit the mandarin‟s ... In addition, Marcyliena (1998) defines directness in conversations as the absence of indirection and audience collaboration and a disregard for social context His definition makes the notion of ... element influencing its directness Directness is available in educational, work, and legal contexts where formal communication is defined in relation to tasks and individual activities and where...
- 53
- 623
- 3
Báo cáo sinh học: "Physical forces in myelination and repair: a question of balance" potx
Ngày tải lên :
06/08/2014, 19:21
... [8] In MS, unknown molecular triggers induce an inflammatory reaction in the brain leading to an invasion and activation of immune cells (B and T lymphocytes and macrophages) and/ or the production ... implication of the results of Simons and colleagues [5] is that increased rigidity in the scarred brain may play a role by unbalancing the intracellular and extracellular forces and inhibiting oligodendrocyte ... production of antibodies directed against myelin components These events lead to the damage and degeneration of the myelin sheath Remyelination does occur in the early stages of the disease as intrinsic...
- 4
- 266
- 0
Báo cáo lâm nghiệp: "Macronutrients in tree stems and foliage: a comparative study of six temperate forest species planted at the same sites" pps
Ngày tải lên :
08/08/2014, 01:22
... (1.0) a Cation exchange capacity was determined as the sum of the extractable amounts of H+, Na+, K+, Ca+, Mg2+, Al3+, Fe3+ and Mn2+ from the BaCl2 extraction b Base saturation was calculated as ... site (DK-1), which was situated in Jutland, near Kragelund (56° 10’ N, 9° 23’ E), had developed on medium sandy till and was classified as Haplic Alisol [20] The soil at the other Danish site (DK-2) ... characteristics of the soil nutrient conditions in topsoil at each site are presented in Table II Tree heights and diameters at breast height (DBH) were measured and used for calculation of the basal area and...
- 10
- 443
- 0
Báo cáo khoa học: "Radial variations in wood mineral element concentrations: a comparison of beech and pedunculate oak from the Belgian Ardennes" pps
Ngày tải lên :
08/08/2014, 14:21
... explanation can lie in a systematic decrease of wood cation binding capacity (CBC) with ageing as shown by Momoshima et al in Japanese cedar [24] CBC has apparently never been assessed in oak and ... Quercus and one Castanea) studied by Okada et al [25], Fagus sylvatica is unusual in having decreasing concentrations of metals from pith to cambium That pattern was already reported by Hagemeyer ... Wood aluminium concentrations in 5-year growth intervals in Fagus sylvatica L (white dots) and Quercus robur L (black dots) (mean and standard deviation over five individuals) Figure Al/Ca and...
- 8
- 230
- 0
Báo cáo y học: "PTPN22 polymorphism and anti-cyclic citrullinated peptide antibodies in combination strongly predicts future onset of rheumatoid arthritis and has a specificity of 100% for the disease" ppsx
Ngày tải lên :
09/08/2014, 07:20
... Sweden Health and Disease Study (NSHDS) All adults in Västerbotten county were invited to participate; consequently, the cohort is population-based and no individual was excluded The Medical ... have developed This is the first study to show an association between the PTPN22 1858T variant and a disease related autoantibody, and that they co-operate to increase the relative risk of developing ... helpful discussion regarding statistical analyses and Ewa Berglin, MD, Department of Rheumatology, for discussion regarding the material Erik Jidell, MD Department of Transfusion Medicine, Ulf Sundin,...
- 6
- 322
- 0
Báo cáo khoa học: "Density of CD4(+) and CD8(+) T lymphocytes in biopsy samples can be a predictor of pathological response to chemoradiotherapy (CRT) for rectal cancer" ppt
Ngày tải lên :
09/08/2014, 09:20
... participated in the study design and data retrieval and analysis KY, KK, ES participated in immunostaining and data analysis HN participated in the management of this study All authors read and ... tumor was measured by barium enema study before and after CRT, and the ratio of tumor reduction was calculated Histological response grade was evaluated by pathologists according to the definitions ... was determined by CT scan, and circumferential extent and distance from anal verge by colonoscopy Histological grade was determined by Japanese criteria for colorectal carcinoma Yasuda et al...
- 6
- 371
- 0
Báo cáo y học: "Tibialis posterior in health and disease: a review of structure and function with specific reference to electromyographic studies" pot
Ngày tải lên :
10/08/2014, 21:23
... limited to only adult and older adult participants Despite the absence of normative data, other studies have investigated TP EMG activation with pathological conditions including rheumatological and ... during walking Tibialis posterior EMG in health and disease Current literature has characterised TP EMG during gait among normal and pathological populations and with various interventions including ... the insertion and identification of the neurovascular bundle and anatomical variants A recent investigation of TP intramuscular electrode insertion, via the posterior approach, was undertaken in...
- 8
- 530
- 0
báo cáo khoa học: " Discovery of microvascular miRNAs using public gene expression data: miR-145 is expressed in pericytes and is a regulator of Fli1" pps
Ngày tải lên :
11/08/2014, 12:20
... miR-145 3' UUCCCUAAGGACCCUUUUGACCUG |||||||||| Mouse 5' CUUGAAGAGAUAAGAAAACUGGAU Human 5' CUUGAAGGGAAGACAAAACUGGAU Rat 5' UUUGAAGAGAUAAGAAAACUGGAU Dog 5' CUUGAAGAGAAAACAAAACUGGAU 5' 3' 3' 3' 3' ... UUCCCUAAGGACCCUU UUGACCUG ||| ||||||| 5' UCA-AUUCAGUGGAUGGCAACUGGAA 5' CAA-AUUCAGUGGAUGGCAACUGGAA 5' UUA-AUUCAGCGGAUGGCAACUGGAA 5' AUAUAUUCAGUGGAUGGCAACUGGAA (b) 3' UUCCCUAAGGACCCUUUUGACCUG || ... analyzed data and drafted the manuscript; PFF designed and performed research, isolated vascular fragments, performed miRNA expression analysis, and together with IB planned and performed microfluidic...
- 12
- 242
- 0
báo cáo khoa học:" Quality of life among patients receiving palliative care in South Africa and Uganda: a multi-centred study" ppt
Ngày tải lên :
12/08/2014, 01:22
... Ugandan validation made only a few minor changes to the wording of items Finally, the Ugandan version was validated only in advanced AIDS patients, while our population of interest was all patients ... Quality of Life Index (MVQOLI) The MVQOLI was developed by Byock and colleagues to measure adaptation to, and integration of, physical and functional decline, as well as attainment of tasks of life ... Life Index (MVQOLI), a 26-item measure originally developed and validated in the USA [43], was administered by Namisango et al to 200 patients with advanced AIDS in urban Kampala [44] The authors...
- 14
- 229
- 0
Báo cáo y học: "Homeostatic mechanisms in dopamine synthesis and release: a mathematical model" pptx
Ngày tải lên :
13/08/2014, 16:20
... (cda, vda) dt cat +VDAT (eda) − k cdaab ⋅ cda d( vda) = VMAT (cda, vda) − fire(t ) ⋅ vda dt d( eda) = fire(t ) ⋅ vda − VDAT (eda) dt −VCATAB(eda) − k rem ⋅ eda d( hva) catab catab = k cda ⋅ cda + ... Then eda gradually decreases to an intermediate value since the increased binding of eda to the autoreceptors inhibits TH and this causes a gradual decline in vesicular dopamine over a nine hour ... Tyrosine is converted into L-3,4dihydroxyphenylalanine (l-dopa) by tyrosine hydroxylase (TH) and l-dopa is converted into cytosolic dopamine (cda) by aromatic amino acid decarboxylase (AADC) Cytosolic...
- 20
- 367
- 0
Báo cáo y học: "Evaluating movement disorders in pediatric patients receiving risperidone: a comparison of spontaneous reports and research criteria for TD" pot
Ngày tải lên :
13/08/2014, 18:21
... reported adverse event at discontinuation (case 1, dyksinesia; case dyskinesia and tardive dyskinesia, case 3, tardive dyskinesia; case 4, extrapyramidal disorder, hypertonia, hypokinesia; case 5, ... hydrate, and melatonin), and anticholinergic medication for any extrapyramidal symptoms arising during the study Measures Efficacy and safety assessments were completed and have been detailed elsewhere ... [8,9], and a one-year, open- label study in children with DBDs and subaverage intelligence Detailed descriptions of patient populations, study designs, treatment, measures, and data analyses have...
- 9
- 332
- 0
hendrickson - regulation and instability in u.s. commercial banking; a history of crises (2011)
Ngày tải lên :
01/11/2014, 22:58
... branching and regulation such as the tax on bank capital and deposit insurance A landscape of many small banks is very different from a landscape of a few large banks Canada is an example of a ... Vallelado (editors) FRONTIERS OF BANKS IN A GLOBAL WORLD Simon Mouatt and Carl Adams (editors) CORPORATE AND SOCIAL TRANSFORMATION OF MONEY AND BANKING Breaking the Serfdom Anastasia Nesvetailova ... and Alper Kara ¸ SYNDICATED LOANS A Hybrid of Relationship Lending and Publicly Traded Debt Yener Altunbas, Alper Kara and Öslem Olgu ¸ TURKISH BANKING Banking under Political Instability and...
- 313
- 345
- 0
Confucianism and yijing a study of their intellectual relationship in pre qin china
Ngày tải lên :
14/09/2015, 10:37
... had in fact developed a theory of human nature and the way of Heaven (性与天道) with his study of the Yijing in his later years Based on a thorough examination of internal textual evidence and archaeological ... archaeological findings, the dissertation also discusses the dating of the Yizhuan, and dates it to no later than the middle of the Warring States period The dissertation concludes with a chapter ... the Qing dynasty and the Republican period challenged this traditional view, and the authorship of the Yizhuan and the relationship between the Yijing and early Confucianism has since become a critical...
- 284
- 1.4K
- 0
Power, leadership and morality a reading of ken aroks images in indonesian literature and popular culture
Ngày tải lên :
16/09/2015, 17:14
... The Pararaton: A Study of Southeast Asian Chronicle (New Delhi: Sundeep Prakashan, 1996) The founder of the Rajasa dynasty, Sanggrama Wijaya, or Kertarajasa Jayawardhana was the son -in- law of the ... conducted during fieldwork in Singasari, Malang, Yogyakarta, Bojong Gede and Jakarta during the period from June to December 2002 as well as in Bandung and Jakarta from late April to June 2003 An ... the last king of Singasari, King Kartanegara Claiming dynastic continuity with the Singasari Kingdom, Wijaya partially took the official name of its founder Ken Arok or Sang Rajasa Sang Amurwabhumi...
- 221
- 1K
- 0