list the properties that a person should look for in a tensor because numerous useful theorems exist for tensors with certain properties

List the components of a radio system

Ngày tải lên : 13/09/2012, 10:52

... supplied with electricity • Increases a signal’s intensity or strength – By using the input signal to control a circuit that “shapes” the output • To reflect the shape of the input signal exactly Amplifiers ... High-rate PN code is combined with the data to be sent – Imprints a unique address on the data – The longer the code is, the more users will be able to share the same channel – Number of chips in the ... Multiple Access (CDMA) (continued) – Advantages • Can carry up to three times the amount of data as TDMA • Transmissions are much harder to eavesdrop on • A would-be eavesdropper must also know the...

30
920
0

báo cáo khoa học: " Debunking the claim that abstinence is usually healthier for smokers than switching to a low-risk alternative, and other observations about anti-tobacco-harm-reduction arguments" potx

Ngày tải lên : 11/08/2014, 18:20

... given accurate information The usual explanation for the lack of such information is that anti-tobacco extremists promulgate disinformation it and then even the opinion leaders who Page of 10 (page ... by addressing the assertion that total social (population) risk will increase if THR is embraced, explaining how that is insupportable, before continuing to the new analysis of the individual ... almost as bad as continuing to smoke, rather than the obviously more accurate message that it is almost as good as quitting entirely Answering this is useful for understanding the significance of the...

10
205
0

báo cáo khoa học: " A quasi-experimental test of an intervention to increase the use of thiazide-based treatment regimens for people with hypertension" docx

Ngày tải lên : 11/08/2014, 05:22

... study, the GMS ambulatory practice was a teaching service that included approximately 150 trainee physicians in postgraduate years one to three during any academic year, staff assistants, and roughly ... that a deputy secretary of the Department of Veterans Affairs has stated that he will return any financial saving reaped by increased use of thiazide-based regimens to the VA medical center that ... was associated with a modest increase in BP goal attainment rates Because relatively small reductions in blood pressure translate into meaningful reductions in the risk of stroke, heart attack,...

13
344
0

Báo cáo y học: "The clinical effectiveness of different parenting programmes for children with conduct problems: a systematic review of randomised controlled trials" ppt

Ngày tải lên : 13/08/2014, 18:21

... alternative form of parent training: 17 of these compared parent training with an alternative form of parent training only (no control comparison group) and 11 studies compared parent training with ... result of the data available it was not possible to incorporate the findings from all of the studies into the meta-analyses As noted above, there was also a lack of independent assessments of the presence ... objective clinical criteria, the clinical cut-off point on a well validated behaviour scale or informal diagnostic criteria), (c) the intervention was a structured, repeatable (manualised) parenting...

10
303
0

Báo cáo y học: "The appropriateness of single page of activation of the cardiac catheterization laboratory by emergency physician for patients with suspected ST-segment elevation myocardial infarction: a cohort study" doc

Ngày tải lên : 13/08/2014, 23:20

... Association, Canadian Cardiovascular Society: ACC/AHA guidelines for the management of patients with ST-elevation myocardial infarction; a report of the American College of Cardiology/American ... managed the data and critical revisions to the manuscript CSY conceived the research and drafted the manuscript Each authors has read and approved the final manuscript Competing interests The authors ... Vetrovec GW: An evaluation of the accuracy of emergency physician activation of the cardiac catheterization laboratory for patients with suspected ST-segment elevation myocardial infarction Ann Emerg...

6
232
0

The status, the factors that influence gender imbalance at birth in bac giang province and some effective interventions

Ngày tải lên : 11/05/2016, 09:58

... this is a major obstacle to the propaganda by Bac Giang, over 90% of the population live in rural areas In the opinion of the subjects, the monitoring of implementation of the law of the authorities ... has FSS in the last birth: Graph 3:8 Rate object has FSS in last birth (n = 1,164) 18.0% has FSS in last birth; + The reason for performing the abortion of the objects Graph 3.10 Reason for abortion ... seminars in three districts, in social seminars 2.2.3 Intervention studies 2.2.3.1 The content and the interventions - Intervention on the scale of the province: perform the state management measures...

24
252
0

An investigation into the first year english Majors some strategies for dealing with unfamiliar words for better EFL reading comprehension and recommendations

Ngày tải lên : 06/10/2014, 15:29

80
598
0

Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc

Ngày tải lên : 16/02/2014, 09:20

... conserved active-site motifs, RHGXRXP and HD, and hydrolyze metal-free phytate with pH optima in the acidic range They consist of two domains, a large a ⁄ b domain and a small a domain with the catalytic ... inside helix A are separated by large distances The corresponding region in AppA shows severe conformational changes upon substrate binding Averaged distances for pairs of Ca atoms matching in ... substrate-free ˚ AppA the Ca atoms are 2.41 A apart, whereas for the substrate-free PhyK and the substrate-loaded AppA ˚ the averaged distance is only 1.87 A Distinct conformational changes were observed...

13
766
0

Tài liệu www.it-ebooks.info.www.it-ebooks.info.www.it-ebooks.infoOffice 2010THE MISSING MANUALThe book that should have been in the box®ˇDownload from Wow! eBook .www.it-ebooks.infoDownload from Wow! eBook .www.i docx

Ngày tải lên : 17/02/2014, 15:20

... Paragraph Formatting: Aligning, Indenting, Spacing Aligning Text Indenting Paragraphs Spacing Within a Paragraph Spacing ... Making Backups Saving a Database with a Different Name or Format Opening Databases Designating a Database as Trusted Opening Recent Databases ... Matthew MacDonald David Pogue’s Digital Photography: The Missing Manual by David Pogue Dreamweaver CS4: The Missing Manual by David Sawyer McFarland Dreamweaver CS5: The Missing Manual by David...

956
6.4K
0

Tài liệu The Cost of a Military Person-Year - A Method for Computing Savings from Force Reductions pptx

Ngày tải lên : 17/02/2014, 23:20

... regular military compensation (RMC) RMC includes average basic pay for each military grade, basic allowance for housing, basic allowance for subsistence, and federal tax advantage accruing to the ... estimate the cost of a military personyear It then presents a more economically accurate alternative approach that allocates total accrual charges across person- years The Principle and Practice ... computation of the cost of a current military personyear Eliminating legacy costs from the calculus, the savings that could be obtained from civilianizing an average military position are therefore...

153
396
0

Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

Ngày tải lên : 18/02/2014, 08:20

... both in wild-type and DQCR10 strains (Fig 2C) Such an analysis demonstrated that all the bc1 subunits were present in comparable amounts in both yeast strains Therefore, the reason for the disappearance ... temperature; each gel strip was then placed horizontally in the gel-pouring apparatus for the second dimension (SDS ⁄ PAGE) [48], already containing the separating gel (15% polyacrylamide and 0.1% ... assistance of speciﬁc chaperone proteins is also required The available data indicate that the accessory factor Bcs1p is involved in the binding of ISP to an immature bc1 intermediate Yeast cytochrome...

15
639
0

Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

Ngày tải lên : 18/02/2014, 08:20

... to and degrade individual polymer chains First, the chains are degraded by both endochitinases, that attack the chitin chain randomly, and exochitinases, that attack the chitin chains from either ... initial phase was maintained longer than in the absence of LlCBP3 3A, indicating that LlCBP3 3A acts synergistically with LlChi1 8A However, the effect of LlCBP3 3A was small and ceased after approximately ... constituting the a + b domain present in ChiA and ChiB, but lacking in LlChi1 8A, ChiC1 and hevamine, are shaded grey Asterisks mark residues that are identical in LlChi1 8A and ChiC1 Small insertions in...

14
683
0

Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modiﬁed conotoxin, reveals that the glycan structure is a-D-Gal-(1ﬁ3)-a-D-GalNAc pot

Ngày tải lên : 23/03/2014, 13:20

... heteronuclear two-dimensional NMR spectroscopy The data clearly indicated that the tx 5a glycan is in an a- D-Gal-(1ﬁ3) -a- D-GalNAc conﬁguration Taken together, these data demonstrate that two Conus glycopeptides ... compared with the calculated average mass Samples for MALDI-MS analysis were mixed with a- cyano-4-hydroxycinnamic acid and irradiated with 282 nm irradiation from a nitrogen laser using a DE-Star (Perceptive, ... and Gal proton resonances were assigned using the aforementioned spectra in combination with NOESY data and a natural abundance 13C-1H HSQC spectrum that enabled each carbon to be correlated with...

11
563
0

Báo cáo Y học: The structure of the O-chain of the lipopolysaccharide of a prototypal diarrheagenic strain of Hafnia alvei that has characteristics of a new species under the genus Escherichia pot

Ngày tải lên : 24/03/2014, 04:21

... observed The repeating unit of the polysaccharide thus contains a terminal NeuAc, and the above mentioned residues A comparison to the methylation analysis data on the O-polysaccharide, indicates that ... was an lipopolysaccharide or a capsular polysaccharide and the fraction was not further investigated The proportion of the minor polysaccharide was indicated by the size of the minor peaks in the ... minor peak just after The material in the major peak was devoid of neuraminic acid The second minor peak, which was included in the column and had four signals in the anomeric region of the H-NMR...

7
463
0

Báo cáo khoa học: Sugar and alcohol molecules provide a therapeutic strategy for the serpinopathies that cause dementia and cirrhosis pot

Ngày tải lên : 30/03/2014, 11:20

... neuroserpin results in an increase rather than a decrease in CD signal [6,19] This implies that, rather than measuring melting, the assay is reporting an increase in secondary structure The most ... neuroserpin, and 0.18 mgÆmL)1 for Z a1 -antitrypsin that had been incubated with sugars for h before dialysing into NaCl ⁄ Pi The transition points were calculated using an expression for a two state transition ... a1 -antitrypsin [46] and increased the secretion of the Z variant of a1 -antitrypsin in a cell-culture model of disease [39] The serpinopathies have obvious parallels with other conformational diseases that...

13
494
0

Báo cáo khoa học: Identiﬁcation of the epitope of a monoclonal antibody that disrupts binding of human transferrin to the human transferrin receptor pptx

Ngày tải lên : 30/03/2014, 11:20

... AAAGAATTCTTAACCTGAAAGCGCCTGTGTAG AAAGGATCCCCCAACAACAAAGAGGGATACT AAAGAATTCTTAGGTGCTGCTGTTGACGTAATAT AAAGGATCCAAGGAAGCTTGCGTCCACAAGATA AAAGAATTCTTAGGCAGCCCTACCTCTGAGATTTT c AAAGAATTCTTAGGTGGTCTCTGCTGATACACACTC c AAAGAATTCTTAATGCAGTCTTCGGTGGTCTCT ... AAAGCGGCCGCTTAGCATGTGCCTTCCCGTAG AAAGGATCCTGCAAGCCTGTGAAGTGG AAAGAATTCATTAAGGTCTACGGAAAGTGCAGG b AAAGGATCCATGAAGTGGTGTGCGCTGAG AAAGAATTCTTACAGGTGAGGTCAGAAGCTGATT AAAGGATCCAATTTTGCTGTAGCAGTGGTGAA AAAGAATTCTTAACCTGAAAGCGCCTGTGTAG ... AAAGAATTCTTAATGCAGTCTTCGGTGGTCTCT c AAAGAATTCTTACTTGCCCGCTATGTAGACAAA c AAAGAATTCTTAATCCTCACAATTATCGCTCTTATT c AAAGAATTCTTACCCTACACTGTTAACACT c AAAGAATTCTTAAACACTCCACTCATCACA d GTGTATCAGCAGAGAACACCGAAGACTGCATCGCC...

10
308
0

INDUSTRY SURVEY - What future animators say about what they are looking for in a school, and what professional animators say are the most important things to look for. ppt

Ngày tải lên : 31/03/2014, 15:20

... important to advancing your education as a professional animator They also state the importance of creating and maintaining a professional network One in five animators say they have a mentor at ... curriculum as their top picks Canada also highly valued individual attention, as did Italy at 50% and the United Kingdom at 41% Brazil, India and Spain chose having an innovative teaching/learning experience ... getting started in their animation career Although professional animators got their education in a variety of different ways, they all agreed that in order to really learn animation and improve their...

14
465
0

Chapter 2Communicating Over the Network Quangkien@gmail.com.OverviewDescribe the structure of a network, including the devices and media that are necessary for successful communications. Explain the function of protocols in network communications. Ex potx

Ngày tải lên : 01/04/2014, 12:20

... encapsulations Data Link Header IP Header TCP Header HTTP Header Data Data Link Trailer The receiving host receives the message with multiple decapsulations Data Link Header IP Header TCP Header ... installed – The amount of data and the speed at which it must be transmitted – The cost of the media and installation 17 Local Area Network (LAN) Local Area Network (LAN) An individual network usually ... Processes running on the intermediary network devices perform these functions: – Regenerate and retransmit data signals – Maintain information about what pathways exist through the network and internetwork...

52
550
0

the nothing that is, a natural history of zero - robert kaplan

Ngày tải lên : 05/06/2014, 11:23

... 107), each rank being a hundred times greater than the last Gautama answers: ayuta, niyuta, karikara, vivara, achobya, vivaha, utsanga, bahula, nagabala, titilambha, vyavaithanaprajnapti (! that' s ... individuals and instances, lunging always toward generalities and abbreviating the singularity of things to an Escher array, an orchard seen from the air rather than this gnarled tree and that ... the palace of Indra, King of the Gods 'What are they?' he asks in awe of the ten-year-old boy who stands as a pilgrim before him Each was once an Indra, says the boy: 37 THE NOTHING THAT IS Indras...

238
5.2K
0