... JIS and AMJ carried out the clinical studies and participated in the data analysis EFA and RNG carried out the Luminex immunoassays and participated in the data analysis MS performed the statistical ... concentrations When data from all 1,020 assays were analyzed, the multiplex cytokine system was able to detect plasma cytokines in 710 (69.6%) assays (Here we define 'assay' as each cytokine measured, ... for all assays were performed using the Bio-Plex Manager software Cytokine detection using multiplex bead array assays exhibits high degrees of intra-assay (< 10% variation) and inter-assay (10%...
... Tomiyama H, Ichihashi H, Nagae T, Tanaka N, Takazawa K, Ishimaru S, Yamashina A: Comparison of ankle-brachial pressure index and pulse wave velocity asmarkersof the presence of coronary artery ... triglyceride and HbA1c were also measured by standard analytical techniques ABI and brachial-ankle PWV measurements The ankle and brachial pressures were measured using the volume-plethymographic apparatus ... compared asmarkersof cognitive impairment ina community-dwelling population, and MMSE was used to assess cognitive status The ABI and PWV were measured as indicators of arterial structure and...
... World’Vest Base (WVB) Company as an example Established in 1984, WVB has emerged asa leading global financial information provider specializing in producing non-US company financial databases since ... researcher’s biases This research will use triangulation and peer examination as the ways to increase internal validity for the research Multiple sources of data (primary and secondary data) will ... their financial information solutions The company’s headquarters is in Chicago (U.S.), and it has branch offices in Malaysia, Mexico and Egypt In 2003, when CEO of this company travel around ASEAN...
... participant-observation of these entrepreneurs, I also interacted with local officials, local residents and obtained statistical data from local authorities Access to the informants was not easy, as ... sector asa motor of the socialist market economy and an equal partner of the state sector (Heberer, 2003) In Vietnam, the state has been more ambivalent, skeptical and cautious in its stand towards ... the Union Address Library: http://stateoftheunionaddress.org/2009-barack-obama Chapter 1: Introduction time since the writing of Adam Smith and Karl Marx‟s analysis of capitalism as central to economic...
... hemorrhage [26] as well as to hyponatremia and delayed vasospasm-related ischemic deficits [27] Focal brain edema was related with elevations of ANP and BNP in patients with subarachnoid hemorrhage ... role of ANP in regulating blood flow in the infarcted area was studied in stroke patients anda statistically significant increase in the number of ANP-immunoreactive astrocytes was found in the ... our work adds something new to the understanding of the elevation of CRP and NT-PBNP in the acute phase of stroke both CRP and NT-PBNP are markersof brain edema in stroke at baseline and after...
... ctctgcccactaagggt aaatttcatttaataatgtaatggagatcg 204 IX X ccttttgtgaccatttactaaggata acaatacttagaggatgcatctga accagaaacaggtgaaataact ggtgaagaggcgcataca 157 212 XI ggtatttctgacttgtatgaccatt accagataaacagtaaagcagc ... SBEIIa-D gggtatacctcggtggattc agactagtggaggcgttt 167 V gaaggtatcgtctaattgcatatct caataaattggaaggtgtctcgtt 154 IX accatttactaaggatatttacatgcaa accagaaacaggtgaaataact 151 X XI acaatacttagaggatgcatctga ... tgctgaaggtatcatctaattgc tgaccattaacaatagattagaaggtg 159 VI cagttactctaaatttatgatctggct aggtggaagattgccaag 134 VII VIII cctattgatgccgatatttgatatg aactctgcctactaagggt tcctcgactaaataattggccag acactggaaattccatttaataatgtaac...
... appropriate as an alternative to arterial PaO2 However, the discrepancy between capillary and arterial PaO2 increased with increasing PaO2 Reproducibility of earlobe blood gas measurements was assessed ... (PaCO2 > = 34 mmHg), (ii) normal airway patency and normocarbia, (iii) decreased airway patency and hypocarbia, and (iv) normal airway patency and hypocarbia functional data over a wide range of ... Univariate and multivariate linear mixed model (LMM) analysis evaluating lung function parameters as explanatory variables of PaO2, including adjustment by "year at testing" LMM univariate analysis...
... The Prince of Wales Hospital, Sydney, Australia Anna Machiha, STI HIV/AIDS and TB Programmes, Ministry of Health and Child Welfare, Harare, Zimbabwe Farinaz Rashed Marandi, Department of Bacteriology, ... States of America Patricia Galarza, Sexually Transmitted Infections Reference Centre, National Institute of Infectious Diseases, Buenos Aires, Argentina Amina Hançali, STD Laboratory, Bacterial ... of Great Britain and Northern Ireland Carolyn Deal, National Institutes of Health (NIH), National Institute of Allergy and Infectious Diseases (NIAID), Bethesda, United States of America Jo-Anne...
... directed against mouse Fab and conjugated with alkaline phosphatase The total concentration of MalE-E3-H6 in the binding reaction is given along the x axis, and the optical signal A4 05 in the indirect ... experimental data as described, with KD and the maximal value of the signal as fitting parameters [34] Twelve concentrations were used and each data point was perfomed in triplicate FEBS Journal 273 ... phase, and calculated as the ratio of two rate constants However, values of DDG and DDG¢ for mutant Fab fragments, calculated from values of KD and KD¢, respectively (Table 1), can be compared...
... (in- kind or financial, recovered at sale), and to make an accurate assessment of their outreach and relevance in the rural areas In recent years, ever-increasing numbers of poor farmers in Eastern ... interesting community-based financial service models are on the one hand the financial service associations (FSAs) and village banks, on the other hand the managed accumulating savings and credit associations ... Kenya, these sales are strictly on a cash basis, as the low margins, risks and lack of bank access for traders make credit sales both impractical and unprofitable 51 Asa rare example of trying...
... along with clinical data is a key element for obtaining valid and representative information on drug resistance Surveillance of anti-TB drug resistance should be adopted as an integral part of ... this analysis Statistical analysis Student’s t-test was used for analyzing the significance of difference numerical and proportional quantities P value of
... glutamate was selected asa biomarker of excitotoxic damage, ICAM-1 and IL-6 as inflammatory biomarkers, and MMP-9 as well as cFn as blood brain barrier disruption biomarkers We did not find any ... [6,9,10] Each sample was assayed in duplicate and intra-assay coefficients of variation sample values were always
... glutamate was selected asa biomarker of excitotoxic damage, ICAM-1 and IL-6 as inflammatory biomarkers, and MMP-9 as well as cFn as blood brain barrier disruption biomarkers We did not find any ... [6,9,10] Each sample was assayed in duplicate and intra-assay coefficients of variation sample values were always
... microbiological analyses Inorganic nitrogen was assessed as the sum of ammonium and nitrate: ammonium was extracted in M KCl and was determined following Anderson and Ingram (1993) while nitrate was determined ... Statistical analysis Analysis of variance (ANOVA) was performed to evaluate the main effects of FACE, fertilization, time and their interaction on parameters analyzed Data were tested for normality ... Microbiological parameters related to soil weight are often correlated or combined as an index in order to evaluate the significance of microbial populations and microbial activity in the cycling of elements...
... and the rest of the agriculturally impacted sites Another CCA analysis was performed to include all water quality variables as well as land use data for each sampling site Adding land use characteristics ... according to the availability of physico-chemical data and on the ba- sis of land use information with the aim of sampling across a gradient of farm types and intensities Physico-chemical measurements ... structure No additional resolving power was obtained by including cyanobacteria, green algae and flagellates This total community analysis substantially increased variance and sample processing time...
... families including Araucariaceae, Cephalotaxaceae, Cupressaceae, Phyllocladaceae, Pinaceae, Podocarpaceae, Sciadopityaceae, Taxaceae, and Taxodiaceae With the exception of Phyllocladaceae, all families ... cells In Cephalotaxus drupacea, five amino acids were isolated – proline, asparagine, glutamate, alanine and serine [55] The amino acids found in Thuja were: serine, glycine, alanine and glutamate ... araucana Araucariaceae no drop Sciadopitys verticillata Sciadopityaceae pollination drop Taxus baccata Taxaceae pollination drop Cephalotaxus harringtonia Cephalotaxaceae pollination drop Taxodium...
... medication However, in the case of our patient, administration of lithium salts was relatively contra-indicated as an anti-manic agent and clearly contra-indicated asa long-term mood stabilizer ... conception and design of the present study, andin the acquisition of data AK made substantial contributions in the analysis and interpretation of the data He was also involved in drafting the manuscript ... London: Taylor & Francis; 2006 Ramaswamy K, Masand PS, Nasrallah H: Do certain atypical antipsychotics increase the risk of diabetes? A critical review of 17 pharmacoepidemiologic studies Ann Clin...
... coordinating nurses and treating physicians remained blinded to the patients' HLA-DR, anti-CCP and anti-Sa status Serum and DNA materials were coded to ensure confidentiality and blinding of investigators ... anti-CCP antibodies (QuantaLite™; Inova Diagnostics, San Diego, CA, USA; in accordance with the manufacturer's recommendations) Standardized radiographs of the hands and feet were obtained at inclusion ... functional status to maximal disablement) Disease Activity Score using 28 joints and variables (tender and swollen joint counts and CRP; DAS28-3) was calculated with the appropriate formulas http:/...
... Las Palmas, Spain 2Clinic Sciences Department of Las Palmas de Gran Canaria University (ULPGC), Spain 3Radiation Oncology Department, Hospital Universitario de Gran Canaria Dr Negrín, Spain 4Inmunology ... data acquisition and statistical analyses LAHH has written the manuscript and has been aware of the submission process PCL has been involved in conception and design of the study andin drafting ... was always lower than interindividual variation for patients (data not shown) Cutaneous, mucosa, subcutaneous, laryngeal and esophageal toxicities as well as xerostomia were evaluated according...
... measures For each patient at each time point, urine was tested for protein/creatinine ratio (PCR), and serum was tested for albumin and creatinine in the routine clinical laboratory Statistical ... remission was defined as follows: decrease in urine PCR by at least 50%, serum albumin of at least 30 g/L, and either normal serum creatinine if the baseline creatinine was less than 260 μmol/L or a 50% ... nucleosomes and double-stranded DNA (dsDNA), (b) nucleosomes and α-actinin and (c) dsDNA and αactinin Absorbance ratios (ARs) for each assay are plotted against each other The Pearson correlation coefficient...