lipid involvement in viral infections present and future perspectives for the design of antivir

Báo cáo y học: "A unified framework of immunological and epidemiological dynamics for the spread of viral infections in a simple network-based population" ppt

Ngày tải lên : 13/08/2014, 16:21

... overall theoretical understanding, but also inform infection control decisions Methods Combined model for infection dynamics To gain insight into how the basic laws of viral dynamics, within an individual, ... mean viral load, Av (t), in the population was the integral of the mean viral load from the beginning of a given simulation (time 0) until time t, and was used as a proxy for the final size and ... not for citation purposes) Theoretical Biology and Medical Modelling 2007, 4:49 Varying the infecting dose The outcome of viral infection, in general, is thought to be related to the size of the...

13
334
0

Pelvic floor muscle training and adjunctive therapies for the treatment of stress urinary incontinence in women: a systematic review doc

Ngày tải lên : 28/03/2014, 14:20

... effectiveness of physical therapy in clinical practice settings and can the findings in the research settings be generalised to clinical practice? Methods Criteria for inclusion in this review The methods ... training (inducing muscle hypertrophy) or skill training (improving motor learning), and their exercise dosage (frequency, intensity, duration of the training programs and compliance) [10] The ... the differences in outcome The expertise of health professionals may vary and also the quantity and quality of the educational information about the condition and PFM function The impact of these...

28
738
0

Báo cáo hóa học: " Fowlpox virus recombinants expressing HPV-16 E6 and E7 oncogenes for the therapy of cervical carcinoma elicit humoral and cell-mediated responses in rabbits" pot

Ngày tải lên : 18/06/2014, 16:20

... responses in humans Further improvements of the recombinants, using the E6 and E7 transgenes deleted of the p53 and p105Rb cellular binding domain, might further increase the safety of the vaccine ... expressed in HPV-transformed cells [48], represent the main target for immune therapy, as they maintain the proliferative state and prevent apoptosis [49,50] In the present study, we have described the ... cytokine determination by the QuantiGene 2.0 Reagent system The RNAs of the different PBMC samples from all of the bleeding times were used in duplicate to determine the levels of expression of the...

12
456
0

Báo cáo toán học: "Invariant and coinvariant spaces for the algebra of symmetric polynomials in non-commuting variables" pps

Ngày tải lên : 08/08/2014, 12:23

... features of S and T Section describes the place-action structure of T and the original motivation for our work Our main results are proven in Sections and We underline that the harder part of our ... decomposes into three irreducible components, with the trivial representation s6 being the span of m222 inside Λ 4.3 Λ meets S S We begin by explaining the choice of normalizing coefficient in (16) ... S W the ring of W -invariant polynomials for this action To finish parsing (1), recall that SW stands for the coinvariant space, i.e., the W -module W SW := S/ S+ (2) defined as the quotient of...

17
364
0

Báo cáo lâm nghiệp: "of morphological characters and molecular markers for the analysis of hybridization in sessile and pedunculate oak" pps

Ngày tải lên : 08/08/2014, 18:21

... situated on the side of the species in the majority represented in the neighbourhood, the sessile oak The comparison of the mean values of the groups on the first axis of DFAa by means of the F-test ... the individuals and all the characters were included in the analysis (DFAa) Second, the individuals of the groups ses/ses and ped/ped were considered as principal points, and individuals of the ... at the within-group level Among all of these characters, 31 present significant differences and of the genotype P : +/n Knowing the frequency PA+ of the phenotype A+ and f, the frequency of the...

13
404
0

báo cáo khoa học: " Collaborations for Leadership in Applied Health Research and Care: lessons from the theory of communities of practice" doc

Ngày tải lên : 10/08/2014, 11:20

... characterised by the support for formal and informal interaction between novices and experts, the emphasis on learning and sharing knowledge, and the investment to foster the sense of belonging among ... long as there is relevance to the topic and interest in learning together This distinction has, however, been criticised for being rather vague and contradictory; for instance, the notion of self-selection ... used in the field of implementation research [66] The main strength of the CoP theory is that it is able to provide a basis for the development and delivery of theoryinformed implementation interventions...

10
323
0

Báo cáo y học: " Peripheral blood and neuropsychological markers for the onset of action of antidepressant drugs in patients with Major Depressive Disorder" pps

Ngày tải lên : 11/08/2014, 16:23

... of 25% in healthy control is assumed Therefore, it is planned to assess 70 healthy controls Page of 10 high in the first rating and increased during the course of the training [64] The training ... role in the conception of the study design, in the writing of the manuscript or the decision to submit the manuscript for publication The BMBF has no role in the currently ongoing collection of ... carried out following a discussion of the results Psychologists of the in the participating trial sites were trained in the application of the neuropsychological tests At the beginning, all raters...

10
1.2K
0

Báo cáo y học: "Viral and cellular requirements for the budding of Feline Endogenous Retrovirus RD-114" ppt

Ngày tải lên : 11/08/2014, 21:22

... tetraubiquitin chains The components of ESCRT complexes participate in inward invagination and budding of late endosomal membranes to form MVB Therefore, the processes of virus budding and MVB vesicle ... of forward and reverse primers, and µl of RNA sample The thermal profile was at 42°C for and 95°C for 10 s, followed by 45 cycles of 95°C for s, 60°C for 20 s, and 72°C for 15 s Thermal cycling ... abrogations of the functions of these cellular factors using dominantnegative mutants or siRNA inhibit viral release of various enveloped viruses possessing Ldomains In this study, to obtain the information...

16
450
0

Báo cáo khoa học: "Genomic variability in Potato virus M and the development of RT-PCR and RFLP procedures for the detection of this virus in seed potatoes" ppt

Ngày tải lên : 12/08/2014, 04:21

... were designed and RT-PCR procedures were developed for the specific detection of PVM in various potato samples and for the confirmation of PCR amplicons The efficacy of RT-PCR for indexing seed ... CTTCATTTGTTATTCGACTT) and PVM2 (Forward: ATGGGAGATTCAACRAAGAA) were used for amplifying the entire CP gene and the nucleotide sequences of the amplicons (917 bp) were then determined in both directions using the ... characterizations of PVM isolates HX designed and coordinated the study and carried out the genetic analysis All authors read and approved the final manuscript Competing interests The authors declare that they...

7
452
0

Relevance of mineral nutrition and light quality for the accumulation of secondary metabolites in centella asiatica and hydrocotyle leucocephala

Ngày tải lên : 19/11/2015, 16:47

... at the expense of centelloside synthesis Therefore, the objectives of the present study were to examine the significance of N, P, or K supply for herb and leaf production and for saponin and ... leaf The comparison of the red and UV excitation quantifies the screening effect due to polyphenols and therefore the content of the latter in the epidermis (modified after Force-A, 2010) The ... either N, P, or K in the range of to 150% of the amount in a standard Hoagland solution favor herb and leaf yield of Centella asiatica but decrease saponin and sapogenin concentrations in the...

149
319
0

Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge

Ngày tải lên : 05/09/2013, 10:15

... govern the washout of sludge from the reactor, and therefore, we investigated the effect of surface loading rate and aeration rate on the selection of well-settling sludge and the formation of aerobic ... NH4-N loading rate Iron in the form of FeSO47H2O and phosphorus in the form of KH2PO4 were added to the influent as a trace metal and nutrient, respectively Aerobic granular sludge used for characterization ... granulation in a continuous-flow reactor Both surface loading and aeration rates affect the selection of well-settling sludge and the formation of aerobic granular sludge By setting and controlling adequate...

8
481
0

Tài liệu Closing the gap between research and practice: Foundations for the acquisition of literacy pptx

Ngày tải lên : 17/02/2014, 06:20

... reading and writing, as distinct from the skills of listening and speaking The teaching of more advanced skills and knowledge leading to the development of critical thinking skills in other areas of ... substantial variation in the sample sizes Because of the great range in the nature and design of the studies examining the effects of guided reading, and in many cases the lack of either transfer or ... recognition) and comprehension in the case of reading, and spelling and ideation (or the generation and organisation of ideas) in the case of writing Thus word recognition combined with the skills involved...

46
1.1K
0

Báo cáo khoa học: The structural comparison of the bacterial PepX and human DPP-IV reveals sites for the design of inhibitors of PepX activity pot

Ngày tải lên : 23/03/2014, 13:20

... lactis The results are presented in Table and Fig 4A For the cluster of lowest energy, both the position and the conformation of the ligand are close to those observed in the 3D structure of the ... residues involved in positioning the substrate in the active site (labelled Pos1 to Pos4); residues involved in the stabilization of the substrate in the active site (Stb1 and Stb2); those forming the ... group of the ligand and the NH2 of Asn470 (equivalent to Asn710 in DPP-IV) Another potential bond can be proposed between the OH atom of Tyr380 and the carbonyl group of the ligand Finally, the...

10
561
0

Charity Law & Social Policy National and International Perspectives on the Functions of the Law Relating to Charities pptx

Ngày tải lên : 29/03/2014, 05:20

... receive it; in protecting the value of the gift; and in supporting and regulating the proper and efficient functioning of the relationship It is the policies informing the State’s role in the gift ... permits the systematic gathering of information and the profiling of functions and policy in respect of Australia and New Zealand, the United States, Singapore and Canada Part IV, the final section, ... with the passing of the centuries, it remains the crux of the charitable relationship and continues to be defined within the common law parameters as set by the Preamble,31 the ‘spirit and intendment’...

623
524
0

$báo cáo hóa học:"Necessary and sufficient condition for the smoothness of intersection local time of subfractional Brownian motions" docx$

báo cáo hóa học:"Necessary and sufficient condition for the smoothness of intersection local time of subfractional Brownian motions" docx

Ngày tải lên : 18/06/2014, 15:20

... completes the proof of Theorem Smoothness of the intersection local time In this section, we consider the smoothness of the intersection local time Our main object is to explain and prove the following ... for all t, s ≥ Existence of the intersection local time The aim of this section is to prove the existence of the intersection local time of S H and S H , for an H = and d ≥ We have obtained the ... [0,T ]4 for all T ≥ This completes the proof Regularity of the intersection local time The main object of this section is to prove the next theorem dudvdsdt 16 Theorem Let Hd < Then, the intersection...

21
532
0

$Báo cáo hóa học: " Necessary and sufficient condition for the smoothness of intersection local time of subfractional Brownian motions Guangjun Shen" pptx$

Báo cáo hóa học: " Necessary and sufficient condition for the smoothness of intersection local time of subfractional Brownian motions Guangjun Shen" pptx

Ngày tải lên : 20/06/2014, 23:20

... completes the proof of Theorem Smoothness of the intersection local time In this section, we consider the smoothness of the intersection local time Our main object is to explain and prove the following ... t for all t, s Existence of the intersection local time The aim of this section is to prove the existence of the intersection local time of SH and SH , for an H = and d We have obtained the ... (1) [0,T]4 for all T This completes the proof Regularity of the intersection local time The main object of this section is to prove the next theorem Theorem Let Hd

16
406
0

Báo cáo hóa học: " A combination of hard and soft templating for the fabrication of silica hollow microcoils with nanostructured walls" pptx

Ngày tải lên : 21/06/2014, 04:20

... Additional file 1) In the absence of CMC-COOH, PDI induces the formation of elongated silica particles in the sol-gel reaction mixture, which is attributed to the templating effect of cylindrical self-assemblies ... with inner mesostructure forms in the bulk solution and some of those particles also adhere to the silica layers on the surface of CMCs Finally, upon calcination, the CMCs (hard templates) and ... Innovación, Spain (Project CTQ2008-01979/BQU) for financial support Authors thank Lucia Casal (Universitat de Barcelona, Spain) for his help in the synthesis of PDI dye, and Prof Po-Da Hong and...

7
525
0

Báo cáo hóa học: "Research Article Trace Inequalities for Matrix Products and Trace Bounds for the Solution of the Algebraic Riccati Equations" pot

Ngày tải lên : 22/06/2014, 03:20

... particularly as the dimensions of the system matrices increase Thus, a number of works have been presented by researchers to evaluate the bounds and trace bounds for the solution of the ARE see 6– ... Moreover, in terms of 2, , we know that an interpretation of tr K is that tr K /n is the average value of the optimal cost J ∗ as x0 varies over the surface of a unit sphere Therefore, considering ... bounds for the product of two matrices In symmetric case, a number of works have been proposed for the trace of matrix products 2, 6–8, 17–20 , and 18 is the tightest among the parallel results In...

17
306
0

INSTRUMENTAL AND STATISTICAL METHODS FOR THE COMPARISON OF CLASS EVIDENCE

Ngày tải lên : 24/08/2014, 11:33

... corrected by finding the slope and intercept of the raw data using the outermost points, calculating a new y-value by using the equation for a straight line (𝑦 = 𝑚𝑥 + 𝑏), and then subtracting the calculated ... groupings in data, generating hypotheses for future samples, evaluating dimensionality, and identifying outliers.3, Determining the natural groupings of the variables is the basic objective and ... requires the consideration of every possible pair of clusters being joined together at every step in the analysis The two clusters whose union would result in the minimum increase in information...

245
3.3K
0

the role of organic matter quality and mineral surfaces for the sorption of chlorpyrifos and diazinon on soils, sediments, and suspended estuary sediment

Ngày tải lên : 14/11/2014, 06:28

168
213
0