left but a number with meaning is written left to right 12 345 678 910
Báo cáo y học: "Natural antisense transcripts with coding capacity in Arabidopsis may have a regulatory role that is not linked to double-stranded RNA degradation" ppt
... prediction and identification of cis-natural antisense transcripts in Arabidopsis thaliana Genome Biol 2005, 6:R30 Kiyosawa H, Yamanaka I, Osato N, Kondo S, Hayashizaki Y: Antisense transcripts with FANTOM2 ... thaliana A comparison of the arrangements of overlapping gene pairs in Arabidopsis A comparison of the arrangements of overlapping gene pairs in Arabidopsis thaliana A and A' label the start and end ... Jotham J, May S: NASCArrays: a repository for microarray data generated by NASC's transcriptomics service Nucleic Acid Res 2004:D575-D577 NASCA Arrays: Affymetrix ATH1 arrays database [http:// affymetrix.arabidopsis.info/narrays/experimentbrowse.pl]...
- 10
- 234
- 0
báo cáo khoa học: "Two successful pregnancies in a woman with chronic myeloid leukemia exposed to nilotinib during the first trimester of her second pregnancy: case study" potx
... clinical management of the patient and interpretation of data, PED was supervisor of clinical management of the patient and interpretation of data All authors read and approved the final manuscript ... of hepatotoxicity, imatinib was temporary stopped, and oral contraceptives were discontinued In the weeks after imatinib was stopped, hepatotoxicity was reduced to grade Another attempt at low ... developed grade hepatotoxicity (aspartate aminotransferase (340 U/l: normal range (N)
- 4
- 286
- 0
Báo cáo y học: "Cerebral involvement in a patient with Goodpasture''''s disease due to shortened induction therapy: a case report" pdf
... gas analysis and liver enzymes were normal A chest X-ray was consistent with pneumonia after aspiration Cranial computed tomography was normal Cerebral magnetic resonance imaging (MRI) revealed ... renal replacement therapy was switched to continuous ambulatory peritoneal dialysis Four months later, the patient was readmitted because of a pulmonary complication with anemia due to tracheal suffusions ... basis of a Goodpasture's disease into account In an extensive metaanalysis for ANCA-associated vasculitides, it has been shown that pulsed immunosuppressive therapy with cyclophosphamide has a...
- 5
- 372
- 0
Báo cáo khoa học: "Left-to-Right Target Generation for Hierarchical Phrase-based Translation" doc
... 2005 A hierarchical phrase-based model for statistical machine translation In Proc of ACL 2005, pages 263–270, Ann Arbor, Michigan, June 784 Masao Utiyama and Hitoshi Isahara 2003 Reliable measures ... of phrase-based rules employed in a grammar, we will be able to simulate a phrasebased translation model with various constraints This reduction is rather natural in that a finite state transducer, ... experts to China to train local engineers and to research technology that is appropriate to China’s economic situation Japan sent specialists to train local technicians to the project , in addition...
- 8
- 232
- 0
Báo cáo khoa học: "DETERMINISTIC LEFT TO RIGHT PARSING OF TREE ADJOINING LANGUAGES*" ppt
... (errors are associated with empty table entries) The function GOTOright and GOTOfoo, take a state i and an auxiliary tree # and produce a state j An example of a parsing table for a grammar generating ... appears that a prediction move and more than one reduction move are necessary for auxiliary tree In left to right parsing, a prediction is made to start an auxiliary tree/3 at top left end; a reduction ... discuss the Bottom-up Embedded Pushdown Automaton (BEPDA) which we use in our parser, we will introduce the Embedded Pushdown Automaton (EPDA) An EPDA is similar to a pushdown automaton (PDA)...
- 8
- 218
- 0
Left to right shunt
... ● Large shunts associated with ■ ● ● Pulmonary infections and cardiac arrythmias Higher incidence of pericardial disease with ASD than any other CHD Bacterial endocarditis is rare Differentiating ... Differentiating ASD, PDA and VSD LA Ao ASD PDA VSD Atrial Septal Defect Why the Left Atrium Isn’t Enlarged RA LA RV LV Auckland MRI Ostium Secundum ASD Amersham Auckland MRI SCMR • Discontinuity ... Novartis® Ventricular Septal Defect AV Canal ● ● ● Atrioventricular canal = endocardial cushion type = posterior VSD (5–10%) Location: adjacent to septal and anterior leaflet of mitral valve Large...
- 88
- 234
- 0
A Guide to Effec tive Assessmen t and Instruc t ion for A l l Studen ts, Kindergar ten to Grade 12
... continuum” and can plan personalized and precise assessment and instruction When a consistent approach is used, a team of educators can be engaged in a systematic and collaborative process to share ... accessed at www.edugains.ca/newsite/aer2/index.html Educators in Ontario are increasingly using a promising approach called pedagogical documentation as an assessment for and as learning strategy ... the class It is a resource for planning that conveys a great deal of critical information at a glance, serving as an inventory of accumulated data It is a living document, in that it is both a reference...
- 74
- 632
- 0
Báo cáo y học: "Case report of right hamate hook fracture in a patient with previous fracture history of left hamate hook: is it hamate bipartite" pps
... no history of trauma or surgery to the wrist [10] In our case, there was a denial of traumatic golf injury to the right wrist but was apparent in the left Features of hamate bipartite Features ... x-ray The CT scan revealed a complete, slightly displaced fracture of the hook of the right hamate with associated soft tissue edema [Fig 2] A referral to an orthopedic surgeon was made to assess ... such that the flexor surface of their forearm lies against the film with slight radial rotation and the long axis of their hand is made as vertical as possible The central ray is directed toward...
- 7
- 277
- 0
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)
... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia, ... nước trong”, “Gạo Cần Đước, nước Đồng Nai”, “Cơm Nai, R a; cá Rí, Rang” hay: “Ai miệt Tháp Mười, Cá tôm sẵn bắt, l a trời sẵn ăn ” (ca dao) v.v Trong Gia Đònh thành thông chí (GĐTTC) có đoạn:...
- 137
- 853
- 0
Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx
... degree 5, 6, 6, 7, 12 (This data was obtained with the commands InvariantRing, PrimaryInvariants, and SecondaryInvariants in Magma.) One checks that R = R/f1 R is an integral domain Let S be the ... of Numbers (Notes by B Friedman, Rewritten by Komaravolu Chandrasekharan with the assistance of Rudolf Suter, with a preface by Chandrasekharan), Springer-Verlag, New York, 1989 [21] D J Wright, ... first author was partially supported by NSA Young Investigator Grant MDA90502-1-0097 The second author was partially supported by NSF Grant DMS-0245606 724 JORDAN S ELLENBERG AND AKSHAY VENKATESH...
- 20
- 478
- 0
Cách sử dụng (Something) is down to (a number of something) pdf
... down to half a bag of rice” = “chúng tơi n a bao gạo” Thơng thường bạn nói số lượng vật/ đồ vật bị giảm, bạn liệt kê như: Now it’s down to just me, Claire, and Maria - Hiện tơi, Claire Maria Lưu ... Với viết Daily English Speaking Lesson này, cho hiểu ro cách sử dụng " is down to " giao tiếp thường ngày Hãy xem thực hành cho ! “We’re down to only people now.” Công ty bạn v a gặp phải chút ... bạn bị sa thải Và có bạn, sếp bạn nhân viên Bạn nói chuyện với bạn tình “We’re down to only people now” (something) is down to (a number of something) Khi có nhiều từng, bạn dùng cụm “down to ”...
- 6
- 702
- 2
Báo cáo khoa học: The unique pharmacology of the scorpion a-like toxin Lqh3 is associated with its flexible C-tail pdf
... used to construct HA-Lqh3 using the pET-14b vector as template DNA Primer 1, 5¢- GGCAGCCATATGTGTAATTGTAAGGCA CCAGAAACTGCACTTTGCGC-3¢, was designed to add a sequence encoding Apamin and a linker ... synaptosomes and are practically nontoxic to insects [1]; (b) a- toxins highly active on insects that bind with high affinity to insect Navs and are weakly toxic in mammalian brain; and (c) a- like toxins ... mainly from mutagenesis and comparison of bioactive surfaces and overall structures of pharmacologically distinct toxins These analyses were based on available crystal structures of a- toxins and...
- 14
- 206
- 0
Báo cáo khoa học: Antimicrobial peptides from hylid and ranin frogs originated from a 150-million-year-old ancestral precursor with a conserved signal peptide but a hypermutable antimicrobial domain pot
... antimicrobial peptides from South American hylids [32,34–37] and Asian, European AMWKDVLKKIGTVALHAGKAALGAVADTISQa GLWSKIKEVGKEAAKAAAKAAGKAALGAVSEAVa ALWKNMLKGIGKLAGQAALGAVKTLVGAE ALWKDILKNVGKAAGKAVLNTVTDMVNQa ... ACGTGCTTAGCAACGG-3¢ for caerin 1.15, and for nested PCR: 5¢-ATAACTGGAACAACGTGTGG-3¢ for caerin 1.1, 5¢-CTAAGTGCTCAGCAATGACG-3¢ for caerin 1.11, 5¢-AGCATAACTGGAACGTGGG-3¢ for caerin 1 .12, 5¢-CAGCAATAAGTGGAACAACG-3¢ ... [64] Land areas are shaded Ancestors of Australian hylids are believed to have crossed Antartica to Australia from South America 150–130 Ma Ancestors of Asian, European and North American ranins...
- 14
- 305
- 0
báo cáo hóa học: " Is global quality of life reduced before fracture in patients with low-energy wrist or hip fracture? A comparison with matched controls" docx
... limitation emotional Statistical analysis Statistical analysis was carried out using the Statistical Package for Social Sciences (SPSS) for Windows (version 14.0) Demographic and clinical variables ... b Continuous variables are presented as mean and standard deviation (SD), and group variables as numbers and per cent (%) * Chi-square used to compare categorical data, and ANOVA with Bonferroni ... this paper as a part of a larger study of fracture patients, collected and analyzed the data and wrote the manuscript GH was the principal investigator for the research program in patients with...
- 11
- 514
- 0
Báo cáo sinh học: " Panicovirus accumulation is governed by two membrane-associated proteins with a newly identified conserved motif that contributes to pathogenicity" pptx
... CAGCCAACTGGGCAGCCTCTGTG CTCCAGACAGCCGCCTGGTTAGC CACACCCTGTAGAGGGCTCTCCAG CCTTTCTTATCAGCCACCCTGTAGAG GGAATACAGCTGGCAAGGC TGATCCTGGGCGTATGCGC GCCCCAACTAATGCATTGGTCACTAG CCAAGCAGTCGCATTGGCCCC a The altered nucleotides ... REP/F1 -A F1-313-F2 P31 7A- 989R N32 3A- 1007R L32 5A- 1014R REP/Y -A 1044R-C /A REP/F -A REP/D -A MUTPMV -123 6R REP/W -A CCCCAGCGGCTTCGTTCTTTGC GGAACCCCAGCAAACTCGTTCTTTGC CTGTGGGTTTTGCAACCCCAGCG CAGCCAACTGGGCAGCCTCTGTG ... protoplasts and plants (A) Foxtail millet protoplasts were transfected with transcripts of alanine replicase mutants (Fig 4) and harvested 40 hours postinoculation The RNA was extracted and separated...
- 12
- 307
- 0
Báo cáo y học: "Collagen-induced arthritis in C57BL/6 mice is associated with a robust and sustained T-cell response to type II collagen" pot
... Kameyama T, TaharaHanaoka S, Miyamoto A, Honda S, Matsumoto I, Koyama A, et al.: Critical role of M tuberculosis for dendritic cell maturation to induce collagen-induced arthritis in H-2b background ... with a therapeutic action of methotrexate at a dose comparable to human therapy This is in contrast to CIA in DBA/1 mice, in which methotrexate had no effect One of the anti-inflammatory mechanisms ... mycobacterial component of CFA provides many factors that are able to break tolerance via activation of Toll-like receptors The therapeutic profile of CIA in the B6 mouse was similar to that of RA, with...
- 8
- 372
- 0
báo cáo khoa học: "Acute left ventricular dysfunction secondary to right ventricular septal pacing in a woman with initial preserved contractility: a case report" potx
... Chamber and VVI Implantable Defibrillator Trial Investigators: Dual chamber pacing or ventricular backup pacing in patients with an implantable defibrillator: the Dual Chamber and VVI Implantable ... instauration of optimal medical therapy, our patient remained at NYHA functional class III She was upgraded to a cardiac resynchronization therapy (CRT)device with implantation of a lateral left ... mechanical synchrony, systolic and diastolic ventricular function and cardiovascular morbidity and mortality Alternative RV pacing sites appear advantageous when compared to RVA pacing but their...
- 5
- 262
- 0
Báo cáo y học: "A neonate with left pulmonary artery thrombosis and left lung hypoplasia: a case report" pps
... occurring within this timeline caused an LPA thrombosis and a maturational arrest of the LPA and the left lung Another possible explanation is that he had an abnormal left pulmonary vasculature and ... polymorphism, can also increase risk of neonatal arterial thrombosis [10] Neonatal arterial thrombosis occurs primarily in the aorta and can mimic cyanotic heart disease [1-3] Two babies ElHassan et al Journal ... congenital LPA thrombosis and left pulmonary hypoplasia The pathogenesis of pulmonary hypoplasia is not fully understood, but a normal thoracic cavity volume, adequate respiratory motion and appropriate...
- 5
- 400
- 0
Báo cáo y học: " A neonate with left pulmonary artery thrombosis and left lung hypoplasia: a case report" pot
... occurring within this timeline caused an LPA thrombosis and a maturational arrest of the LPA and the left lung Another possible explanation is that he had an abnormal left pulmonary vasculature and ... polymorphism, can also increase risk of neonatal arterial thrombosis [10] Neonatal arterial thrombosis occurs primarily in the aorta and can mimic cyanotic heart disease [1-3] Two babies ElHassan et al Journal ... congenital LPA thrombosis and left pulmonary hypoplasia The pathogenesis of pulmonary hypoplasia is not fully understood, but a normal thoracic cavity volume, adequate respiratory motion and appropriate...
- 5
- 178
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25