l and transverse t shrinkage stress in a butt weld
báo cáo hóa học: " Brain inflammation and oxidative stress in a transgenic mouse model of Alzheimer-like brain amyloidosis" pptx
... protein standards, internal controls and blanks were always assayed at the same time and in the same way All samples were always determined in triplicate and in a blind fashion Immunoblot analysis ... known amount of the internal standard is added to each sample, after solid phase extraction samples are derivatized and purified by thin layer chromatography, and finally analyzed An aliquot of these ... and the considerable theoretical and therapeutic interest, the relationship between brain inflammation responses and oxidative stress has not yet been clearly delineated in AD For example, its...
- 9
- 490
- 0
Báo cáo y học: "The relationship between predicted peptide–MHC β class II affinity and T-cell activation in a HLA-DRβ1*0401 transgenic mouse model" pptx
... well Cells were harvested onto glass fiber filters (Wallac, Turku, Finland) and radioactivity was determined using a Wallac 1450 Microbeta liquid scintillation counter and UltraTerm software Experiments ... response Although this predictive model may effectively identify peptides that are capable of activating DR4 restricted T cells, it must be noted that additional factors influence the availability ... U/ml penicillin, 100 µg/ml streptomycin, mmol L- glutamine and 50 µmol 2-ME (all from Gibco BRL, Burlington, Ontario, Canada) Cells were then cultured in Falcon 96-well U-bottom tissue culture plates...
- 9
- 530
- 0
Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx
... CGGTTTGTTTGGGTTTGG GTTTGGGTTTGGGTTTGGGTT (forward) and GGC TTGCCTTACCCTTACCCTTACCCTTACCCTTACC CT (reverse), were used to amplify telomeric DNA in the CD4+ and CD8+ T cell subset Six serial dilutions ... work including all the molecular analyses JS participated in the field work; GM and SEM participated in drafting the manuscript All authors read and approved the final manuscript Competing interests ... Jemaneh L, Farnert A, Christensson B: Lymphocyte activation and subset redistribution in the peripheral blood in acute malaria illness: distinct gammadelta+ T cell patterns in Plasmodium falciparum...
- 11
- 527
- 0
báo cáo khoa học: "Evolution of T-cell clonality in a patient with Ph-negative acute lymphocytic leukemia occurring after interferon and imatinib therapy for Ph-positive chronic myeloid leukemia" pot
... expanded T cells was found only in Va10 subfamily in CML-CP, which changed to polyclonally expanded T cells in ALL It may indicate that the polyclonally expanded pattern was a common feature in ... CT and ALL Vb13 or Vb9 and Vb17 were identified at the stage of CT and ALL respectively More oligoclonal TCR Vb T cells were detected after CT for ALL in the patient (Figure and 5) Wang et al ... 5’-TCAGACCCTGAGGCTCAAAGTC-3’ CML (upstream) 5’-CGCATGTTCCGGGACAAAAGC-3’ Results Genetic feature of the CML case Clinical, cytogenetic and molecular features of different disease stage in this patient...
- 7
- 322
- 0
báo cáo khoa học: " Impact of AtNHX1, a vacuolar Na+/H+ antiporter, upon gene expression during short- and long-term salt stress in Arabidopsis thaliana" doc
... of salt treatment, suggesting that cellular signaling was not strongly impacted by AtNHX1 until the later stages of salt stress The only transcripts that displayed a general trend of increased ... growth and to minimize developmental differences among plant lines and treatments Plant were allowed to acclimatize for two days after transplanting and the soil was then saturated with the modified ... (At4g16590 and At1g24070) that were diminished with all treatments, and a pectinacetylesterase (At1g57590) transcript that was diminished after two weeks of salt stress Twelve of the 18 metabolism/energy-related...
- 15
- 330
- 0
Process evaluation and treatability study of wastewater in a textile dyeing industry
... lubricants, dirt and other natural materials, water-soluble sizes, anti-static agents, and fugitive tints used for fabric identification Scouring uses alkali to saponify natural oils & surfactants ... 20 Finally, the wastewater content in the beaker was allowed to settle for 30 minutes and the supernatant was collected for analysis The parameters measured for the supernatant were COD and pH ... two separate collection tanks allotted for Jute and Cotton fabric dyeing and characterized for the relevant parameters A composite wastewater sample was prepared by mixing Jute and Cotton fabric...
- 14
- 534
- 0
Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm
... GA optimization for VAWT wind farm The results are given in Table The optimal layout is the same as that of a HAWT as shown in Figure Table Optimization results for VAWT wind farm Optimization ... In order to maintain genetic diversity, some of the individuals in the group are randomly altered After that, the new generation is finally created Termination: There are several ways to define ... brief introduction to the genetic algorithm Genetic algorithms (GA) are a class of stochastic optimization algorithms inspired by the biological evolution The GA starts with an initial generation,...
- 12
- 635
- 1
Tài liệu COMMUNICATION FROM THE COMMISSION TO THE COUNCIL AND THE EUROPEAN PARLIAMENT Innovation in a knowledge-driven economy ppt
... comparing best practice, – Translating these European guidelines into national and regional policies by setting specific targets and adopting measures, taking into account national and regional ... Establishing, where appropriate, quantitative and qualitative indicators and benchmarks against the best in the world and tailored to the needs of different Member States and sectors as a means ... venture capital operators active in the market, but also in the proportion of overall investment dedicated to early-stage financing and to technology investment The management of high-tech start-ups...
- 32
- 502
- 0
Tài liệu Step-by-Step Guide for Creating and Testing Connection Manager Profiles in a Test Lab doc
... VPN-only profile This test lab scenario also requires manual installation of a certificate chain on CLIENT1 For information about building Connection Manager profiles that automatically install certificates ... Internet Authentication Service Install Click Internet Authentication Service as a subcomponent of the Networking Services component Start, point to Administrative Tools, and click Internet Authentication ... Administration Kit Click Start, point to Administrative Tools, and click Connection Manager Administration Kit On the Welcome to the Connection Manager Administration Kit Wizard page, click Next...
- 59
- 1,146
- 0
Tài liệu Báo cáo khoa học: "Beefmoves: Dissemination, Diversity, and Dynamics of English Borrowings in a German" ppt
... 2008 Automatic detection of English inclusions in mixed-lingual data with an application to parsing Ph.D thesis, Institute for Communicating and Collaborative Systems, School of Informatics, ... Kachites McCallum 2002 Mallet: A machine learning for language toolkit Web: http://mallet.cs.umass.edu Alexander Onysko 2007 Anglicisms in German: Borrowing, lexical productivity, and written ... English) We tested the classifier using 10-fold cross validation on the training data and on a manually annotated development set of 10K consecutive tokens from MZEE All data was lowercased (this improved...
- 5
- 537
- 0
The working families’ tax credit and some European tax reforms in a collective setting pdf
... appreciated The usual disclaimer applies Appendix A Personal income taxation in the UK Table A1 Income tax and National Insurance in 1998/99 Income tax bands: (individual annual income) First £4,195 ... equalization of tax exemption of married and single individuals; (iv) extension of marital quotient to couples with a cohabiting contract A linear taxation system is also modeled, with a negative ... interaction of leisure terms in the utility function, d Relative to the calibrated value of lm there is much less variation in the estimated parameter 3.3 The collective data set Each observation...
- 30
- 304
- 0
Long-term Exposure to Traffic-related Air Pollution and Type 2 Diabetes Prevalence in a Cross-sectional Screening-study in the Netherlands pdf
... Traffic flow data were provided by all national, provincial and municipal authorities in the study area and were linked to a digital map of all roads in the Netherlands (NWB), using GIS Other land ... Table Characteristics of the total population and of participants with and without type diabetes Characteristic Total population Type Diabetes Screening diagnosed Type Diabetes No Type Diabetes ... Sensitivity analyses were done to examine the potential confounding effect of BMI (Additional File Table s2) In these analyses all participants with missing data Dijkema et al Environmental Health...
- 9
- 771
- 0
Pulmonary Tuberculosis: Knowledge, Attitudes and Practices of Selected Physicians in a Tertiary-Care Hospital docx
... problem in the country However, the majority does not favorably rate the National TB Program and DOT The lack of awareness that TB is reportable and the paperwork it entails limits the data on its ... private practitioners, the lack of information on the health authority to contact and not just the paperwork that it entails may have contributed to a certain degree to the poor forwarding of information ... 92% and 3-drug regimen given by 8% of respondents at the initiation of treatment and the total duration of treating a PTB patient usually lasts 6-8 months Eighty two percent (n=31) of the total...
- 10
- 517
- 1
Báo cáo khoa học: "Comparing Objective and Subjective Measures of Usability in a Human-Robot Dialogue System" potx
... slat] To make a windmill, insert the yellow bolt through the middle of this short slat and the middle of another short slat and screw it into the snowman USER [takes slat, performs action] Okay ... success rate at building the three main target objects (windmill, L shape, railway signal): on average, a subject built about two of the three objects correctly The overall correct-assembly rate was ... for each term in the function Although the R2 values for the predictor functions in Table are generally quite low, indicating that the functions not explain most of the variance in the data, the...
- 9
- 310
- 0
Factors affecting delays in diagnosis and treatment of pulmonary tuberculosis in a tertiary care hospital in Istanbul, Turkey pptx
... delays between the onset of symptoms and initiation of treatment in our patients These delays included patient delay, institutional delay, diagnostic delay, and delay in the treatment Both patient ... of institutional delay was not identified in eight patients (4%) CR64 institutional delay diagnostic delay delayed treatment diagnosis interval treatment interval admission to hospital diagnosis ... study These results indicate that the rate of institutional delay was more significant than those of delays in diagnosis and treatment In a previous study, the rates of institutional, diagnostic and...
- 6
- 466
- 0
Báo cáo khoa học: "Combining POMDPs trained with User Simulations and Rule-based Dialogue Management in a Spoken Dialogue System" docx
... dialogue manager The web tool is available at http://cicerone.dit.unitn.it/ DialogStatistics/ Data-centric System Architecture All data is continuously stored in a database which web-service based ... logs) and (annotation view) We are currently extending the visualization tool to display the POMDP-related information that is already present in the dialogue database The visualization tool shows ... heterogeneous types of information at various levels of description in a uniform way This facilitates dialog evaluation, data mining and online learning because data is available for querying as...
- 4
- 269
- 0
Báo cáo khoa học: HIV-1 gp41 and gp160 are hyperthermostable proteins in a mesophilic environment ppt
... the same sample It is generally accepted that MALDI-TOF analysis results in the disruption of all noncovalent interactions and that the observed multimers correspond to covalently linked multimers ... model We have created a triple mutant: Q4 0A/ Q4 1A/ Q5 1A The three amino acids mutated are mainly involved in interactions amongst the three helices N This mutant was substantially stabilized, as shown ... with charged ones This implies that the formation of ion bonds is the dominating mechanism leading to hyperthermostability as a result of adaptation to elevated temperatures This statistical approach...
- 14
- 375
- 0
Báo cáo hóa học: "Evaluation, diagnosis, and treatment of lead poisoning in a patient with occupational lead exposure: a case presentation" pptx
... practices and minimum engineering control, lacking local and general exhaust ventilation and washing facilities culminating into alarmingly high blood lead levels of 128.3 µg/dl According to ... storage of the lead-contaminated protective work clothing and equipment The regulatory body should make it mandatory to evaluate and create awareness in the worker about the ill effects of lead ... the muscle and organs outside the brain In addition lead causes a decrease in muscle strength and eventually at high doses paralysis sets in This affects the radial nerve in particular, causing...
- 4
- 542
- 0
báo cáo hóa học:" Osteoarthritis: quality of life, comorbidities, medication and health service utilization assessed in a large sample of primary care patients" potx
... performed the data management and statistical calculations JS participated in the study design All authors read and approved the final manuscript Acknowledgements This study is part of the PRAXART project ... well as patients' quality of life by tailored interventions A randomly created sample of 75 general practitioners in the area of Baden-Wuerttemberg and Bavaria has been enrolled and recruited the ... regarding health status and health service utilization (HSU) Furthermore, since it is known that quality of life (QoL) of OA patients is mainly determined by pain and disability our aim was to assess...
- 9
- 413
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008