kim george psevdos jr 2008 co infection of hepatitis b and hepatitis c virus human immunodeficiency virus infected patients in new york city united states http www ncbi nlm nih gov pmc articles pmc2773311
Báo cáo sinh học: " Transmission of human hepatitis C virus from patients in secondary cells for long term culture" pot
... gtc ttc acg cag cac tcg caa cca ccc tat cag act gtc ttc acg cag aag cgt cta gcc at cga gac ctc ccg ggg cac tcg caa gca ccc acg cag aaa gcg tct agc cat ggc gtt agt tcc cgg ggc act cgc aag cac cct ... S35-labeled RNA probes and detection of < /b> HCV protein by fluorescence microscopy (A, B) Infected B- cells hybridized with labeled positive-strand RNA probe (C) Freshly transformed uninfected B- cells ... RNA in cultured cells by in situ hybridization with S35-labeled RNA probes and detection of < /b> HCV protein by Figure fluorescence microscopy Detection of < /b> HCV RNA in cultured cells by in situ hybridization...
- 17
- 479
- 0
Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"
... use Patients should be counseled on contaminated equipment being a source of < /b> infection < /b> Addiction care and counseling should be focused on with possible referrals for psychotherapy and detoxification ... for Hepatitis < /b> C virus all need to be elucidated Conflict of < /b> interest The authors have declared that no conflict of < /b> interest exists References WHO Global surveillance and control of < /b> hepatitis < /b> C ... 83 [Internet] CDC: US Viral Hepatitis < /b> C http: / /www. cdc .gov/ ncidod/diseases /hepatitis/< /b> c/ plan/Prev _Co < /b> ntrol.htm 84 Backmund M, Reimer J, Meyer K, Gerlach JT, Zachoval R Hepatitis < /b> C virus infection...
- 6
- 486
- 0
Báo cáo y học: "The Natural History of Hepatitis C Virus (HCV) Infection"
... ages Coinfection with HIV and HBV HCV coinfections with HIV or HBV are significant risk factors for liver fibrosis Coinfection with HCV and HIV is particularly common among hemophiliacs and injection ... alcohol consumption, age of < /b> initial HCV infection,< /b> degree of < /b> inflammation and fibrosis on liver biopsy, HIV or HBV coinfection, and comordid conditions An estimated 10%20% of < /b> chronic HCV infections ... Similarly, HCV coinfection with HBV also exhibits higher rates of < /b> progression to cirrhosis Comorbid Conditions The role of < /b> comorbid conditions and HCV infection < /b> is an important component in the natural...
- 6
- 530
- 0
Báo cáo y học: "Sustained eradication of hepatitis C virus by low-dose long-term interferon therapy in a renal transplant recipient with dual infection with hepatitis B and C viruses: a case report" pptx
... regimens, including ribavirin alone, combination therapy with ribavirin and amantadine [10], interferon in combination with ribavirin [5,11] and interferon alone [12] Combination therapy of < /b> ribavirin ... 2001, 8:690-694 10 Bräu N: Treatment of < /b> chronic hepatitis < /b> C in human immunodeficiency virus /hepatitis < /b> C virus- coinfected patients in the era of < /b> pegylated interferon and ribavirin Semin Liver Dis 2005, ... therapy could achieve sustained eradication of < /b> HCV infection < /b> in renal transplant recipients with dual HBV and HCV infections Consent Written informed consent was obtained from the patient for publication...
- 4
- 282
- 0
Báo cáo khoa học: "Occurrence of Hepatitis C Virus infection in type 2 diabetic patients attending Plateau state specialist hospital Jos Nigeria" doc
... persist, accompanied by variable degrees of < /b> hepatic inflammation and fibrosis Earlier studies of < /b> chronic HCV infection < /b> suggests that only a small number of < /b> hepatocytes become infected, but more recent ... liver cirrhosis: role of < /b> hepatic and non-hepatic influences Eur J Clin Chem Clin Biochem 1994, 32(10):749-58 Del Vecchio Blanco C, Gentile S, Marmo R, Carbone L, Coltorti M: Alterations of < /b> glucose ... http: / /www. virologyj.com/content/6/1/98 Sample Collection ml of < /b> blood was collected from each patient by venepuncture using sterile syringes and needles into a sterile container with a screw cap The blood was...
- 5
- 463
- 0
Báo cáo khoa học: " Three-dimensional Huh7 cell culture system for the study of Hepatitis C virus infection" ppsx
... polarized, xenobiotically-competent cells Figure Robust HCVcc infection < /b> in 3-D Huh7 RWV cultures Robust HCVcc infection < /b> in 3-D Huh7 RWV cultures (A) Huh7 3-D aggregates were infected with HCVcc JFH-1 ... JFH1 cell culture-propagated HCV (HCVcc) viral stocks were obtained by infection < /b> of < /b> naïve Huh7-1 cells at a multiplicity of < /b> infection < /b> (MOI) of < /b> 0.01 focus forming units (FFU)/ cell, using medium collected ... enterocyte-like colon cancer cell lines HT-29 and Caco-2 Cloning of < /b> the complete human coding sequence and changes of < /b> dipeptidyl peptidase IV mRNA levels during cell differentiation J Biol Chem...
- 8
- 326
- 0
Báo cáo khoa học: "Ethnic and geographical differences in HLA associations with the outcome of hepatitis C virus infection" pot
... differences may explain some inconsistencies in HLA associations with HCV infection < /b> The recognition and subsequent destruction of < /b> infected cells by natural killer (NK) cells and virus- specific cytolytic ... the outcome of < /b> HCV infection < /b> is needed ance (Table 1) Chronic HCV infection < /b> was determined by persistently positive detection of < /b> HCV-RNA and antibodies in the blood samples collected at each patient ... non-Caucasian Americans in Baltimore and Chicago (see Table 4) In contrast, DQB1*02 and the haplotype DRB1*03-DQB1*02 are susceptible to HCV infection < /b> in European and Northeastern American Caucasians...
- 8
- 499
- 0
Báo cáo khoa học: " Occurrence of Hepatitis C Virus infection in type 2 diabetic patients attending Plateau state specialist hospital Jos Nigeria" doc
... persist, accompanied by variable degrees of < /b> hepatic inflammation and fibrosis Earlier studies of < /b> chronic HCV infection < /b> suggests that only a small number of < /b> hepatocytes become infected, but more recent ... liver cirrhosis: role of < /b> hepatic and non-hepatic influences Eur J Clin Chem Clin Biochem 1994, 32(10):749-58 Del Vecchio Blanco C, Gentile S, Marmo R, Carbone L, Coltorti M: Alterations of < /b> glucose ... http: / /www. virologyj.com/content/6/1/98 Sample Collection ml of < /b> blood was collected from each patient by venepuncture using sterile syringes and needles into a sterile container with a screw cap The blood was...
- 5
- 209
- 0
Báo cáo khoa học: "Three-dimensional Huh7 cell culture system for the study of Hepatitis C virus infection" pdf
... polarized, xenobiotically-competent cells Figure Robust HCVcc infection < /b> in 3-D Huh7 RWV cultures Robust HCVcc infection < /b> in 3-D Huh7 RWV cultures (A) Huh7 3-D aggregates were infected with HCVcc JFH-1 ... JFH1 cell culture-propagated HCV (HCVcc) viral stocks were obtained by infection < /b> of < /b> naïve Huh7-1 cells at a multiplicity of < /b> infection < /b> (MOI) of < /b> 0.01 focus forming units (FFU)/ cell, using medium collected ... enterocyte-like colon cancer cell lines HT-29 and Caco-2 Cloning of < /b> the complete human coding sequence and changes of < /b> dipeptidyl peptidase IV mRNA levels during cell differentiation J Biol Chem...
- 8
- 642
- 0
Báo cáo y học: "Molecular Virology of Hepatitis C Virus (HCV): 2006 Update"
... protein-membrane interaction, essential cis-acting replication elements (CRE) of < /b> the RNA genome were recently discovered For instance, the sequence coding for the C- terminal domain of < /b> NS 5B consists of < /b> ... immunology of < /b> viral hepatitis < /b> B and C as well as basic and clinical aspects of < /b> gastrointestinal malignancies, especially hepatocellular and colorectal carcinoma Darius Moradpour, MD, was Assistant Professor ... particles from neutralizing antibodies [29] Int J Med Sci 2006, 31 Figure Comparison of < /b> different replicon systems A selection of < /b> different bicistronic and monocistronic replicon constructs including...
- 6
- 497
- 1
Tài liệu Báo cáo khoa học: Limited suppression of the interferon-b production by hepatitis C virus serine protease in cultured human hepatocytes pptx
... analyzed by immunoblotting as described in Fig 6C The black arrowhead indicates the noncleaved TRIF O cells A MycMyc- Cardif Cardif C5 08A 75 kDa 50 37 NS3 b- actin Oc cells B Myc-Cardif C5 08A Myc-Cardif ... protein, according to the previously described method [39] To construct pCX4pur ⁄ myc-TRIF, the EcoRINotI fragment of < /b> pCXpur ⁄ myc-TRIF encoding myc-TRIF ORF [39] was subcloned into the EcoRI and ... performed according to a method described previously [67] The sequences of < /b> sense and antisense primers for TRIF (accession no AB093555) were 5¢-AAGCCATGATGAGCAACCTC-3¢ and 5¢-GTGTCC TGTTCCTTCCTCCAC-3¢...
- 16
- 523
- 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA ... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT ... TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT AGCCATGGTTT AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC GCGGCCGCAAA GGCTGCACGACACTCCGCCATGGCTAGACGCTTTC CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC...
- 15
- 597
- 0
Báo cáo khoa học: Recent contributions of in vitro models to our understanding of hepatitis C virus life cycle pdf
... and collaborators in 1998, with particles produced in insect cells using a recombinant baculovirus containing the cDNA of < /b> HCV structural proteins of < /b> genotype 1b or 1a [48] HCV-like particles ... that HCV binding might induce changes in the cell that could favour HCV infection < /b> [54] In parallel, virus- like particles could constitute attractive vaccine candidates for papillomaviruses and ... To succeed in obtaining HCV infection < /b> in primary human hepatocytes, an existing model of < /b> hepatitis < /b> B virus infection < /b> was used to determine optimal infection < /b> conditions [39,40] Rumin et al pointed...
- 14
- 532
- 0
Commercial Sexual Exploitation of Children in New York City, Volume One: The CSEC Population in New York City: Size, Characteristics, and Needs doc
... Jay), and Jim Bolus and Margo Hirsch (Empire State Coalition), Michele Sviridoff (Office of < /b> the NYC Criminal Justice Coordinator), Kara Kaplan (Office of < /b> the NYC Criminal Justice Coordinator) and ... exploited children in New York City, and the City s response to the problem, conducted by the Center for Court Innovation and John Jay College of < /b> Criminal Justice (see Volume Two for the background ... dearth of < /b> empirical data about the commercial sexual exploitation of < /b> children to offer guidance to policy makers, clearly, the larger context of < /b> the sex business in New York City – in which CSEC markets...
- 126
- 411
- 0
Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc
... TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGA TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG ... GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCAAGATCGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT ... cgucuagccauggcguuaguaugagugucgugcagccuccaggaccccccccucccgggagagccauaguggucu g u domain II a g u u c 200 gcggaaccggugaguacaccggaauuccaggcagaccgguccuuucuuggaucaacccgcucaaugccuggagauu domain IIIa domain IIIb g u u g u 250 uugggcgugcccccgcgagacugcuagccguaguguugggucgcgaaaggccuugugguacugccugauagggu...
- 12
- 354
- 0
Báo cáo sinh học: "A population-based study examining the emergence of community-associated methicillin-resistant Staphylococcus aureus USA300 in New York City" pot
... Annals of < /b> Clinical Microbiology and Antimicrobials 2006, 5:29 http: / /www. ann-clinmicrob.com/content/5/1/29 sess type IV SCCmec gene and the Panton-Valentine leukocidin (PVL)[1,4,5] Two distinctive ... daptomycin) dilution methods, according to CLSI standards [15] Characterization of < /b> bacterial isolates Since susceptibility to clindamycin and possession of < /b> SCCmec IV are typical features of < /b> the ... of < /b> the city Page of < /b> (page number not for citation purposes) Annals of < /b> Clinical Microbiology and Antimicrobials 2006, 5:29 http: / /www. ann-clinmicrob.com/content/5/1/29 likely to be black and female...
- 6
- 364
- 0
Báo cáo khoa hoc:" Refractoriness of hepatitis C virus internal ribosome entry site to processing by Dicer in vivo" ppt
... pre-mmu-miR-328 sequence (5'accgtggagtgggggggcaggaggggctcagggagaaagtgcatacagccc ctggccctctctgcccttccgtcccctgt ttttc-3') (Promega) The Rluc:miR-328 binding site reporter constructs, in which Rluc is coupled ... using forward (5'-gcgcgcggatccgccagccccctgatgggggcgacac-3') and reverse (5'-gcgcgcggatccaggttgcgaccgctcggaagtcttcc-3') oligonucleotides, and cloned in the BamHI site of < /b> pXP2-Luc (Firefly luciferase) ... Journal of < /b> Negative Results in BioMedicine 2009, 8:8 http: / /www. jnrbm.com/content/8/1/8 Figure Recombinant Dicer binds and cleaves HCV IRES in vitro Recombinant Dicer binds and cleaves HCV IRES in...
- 13
- 362
- 0
Báo cáo khoa hoc:" Recurrence of hepatitis C virus during leucocytopenia and spontaneous clearance after recovery from cytopenia: a case report" pot
... hepatitis < /b> C virus after chemotherapy for colon cancer Clin Oncol (R Coll Radiol) 2004, 16:204-205 de Pree C, Giostra E, Galetto A, Perrin L, Zulian GB: Hepatitis < /b> C virus acute exacerbation during chemotherapy ... entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed Central yours — you keep the copyright BioMedcentral Submit your manuscript ... NH, Gerlach JT, Jung MC, Diepolder HM, Schirren CA, Schraut WW, Hoffmann R, Zachoval R, Santantonio T, Cucchiarini M, Cerny A, Pape GR: Association of < /b> hepatitis < /b> C virus- specific CD8+ T cells with...
- 3
- 232
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25