... except year 2009 data used for the following countries: Australia, Brunei Darussalam, Iran (Islamic Republic of) , Libyan Arab Jamahiriya, Qatar, Saudi Arabia, United Arab Emirates, Yemen 14 The absolute ... a comprehensive capability at the global scale is needed to pull together and analyze the wealth of data collections that are available, and to enhance data collection for areas where information ... Biological Diversity (CBD) Target 11: By 2020, at least 17% of terrestrial and inland waters, and 10% of coastal and marine areas, especially areas of particular importance for biodiversity and ecosystem...
... low tax rates—as they hire lawyers and accountants to take particular advantage of loopholes and tax expenditures The average tax rate masks the fact that some high-income Americans pay near their ... of the Richest Americans Pay Extraordinarily Low Tax Rates The average tax rate masks the fact that some high-income Americans pay near their statutory tax rate, while others take advantage of ... wealthiest Americans can hire lawyers and accountants to take advantage oftax expenditures and loopholes that enable them to pay a lower share of their income in taxes than average Americans In particular:...
... trial of the French Sarcoma Group Journal of Clinical Oncology, 2006 ASCO Annual Meeting Proceedings Part I 2006, 24:9516 Jagadeesan J, Bayat A: Transforming growth factor beta (TGFbeta) and ... Cheah A, Turley S, Nadesan P, Poon R, Clevers H, Alman B: Beta-Catenin stabilization dysregulates mesenchymal cell proliferation, motility, and invasiveness and causes aggressive fibromatosis and ... somatic mutations of WNT pathway (APC or CTNNB1) Some studies [8-11] have demonstrated clinical and radiological benefits of imatinib in treatment of AF There is very limited literature on intra-abdominal...
... clinically and statistically significant decrease in duration of mechanical ventilation when using remifentanil-based analgesia and sedation The difference between remifentanil and the comparator ... mechanical ventilation can be achieved significantly faster with remifentanil-based analgesia and sedation • Remifentanil has a very rapid offset even after a 10-day infusion with no evidence of ... analgesia and sedation of mechanically ventilated patients after trauma or major surgery Br J Anaesth 2001, 6:763-768 14 Park G: Improving sedation and analgesia in the critically ill Minerva Anestesiol...
... Kawakami A, Nakashima T, Sakai H, Urayama S, Yamasaki S, Hida A: Inhibition of caspase cascade by HTLV-I tax through induction of NF-kappaB nuclear translocation Blood 1999, 94:3847-3854 Nakashima ... potential for primary T-lymphocytes J Biol Chem 1998, 273:6698-6703 Tanaka A, Takahashi C, Yamaoka S, Nosaka T, Maki M, Hatanaka M: Oncogenic transformation by the tax gene of human T-cell leukemia ... mice are characterized by enhanced levels of apoptosis and oncogene expression J Pathol 1998, 186:209-214 Kitajima I, Nakajima T, Imamura T, Takasaki I, Kawahara K, Okano T: Induction of apoptosis...
... The additive effect ofa mutational allele of the multi-allelic QTL was sampled from the gamma distribution with a shape parameter of 0.4 and scale parameter of 1.66 [13] with an equal probability ... circumstances, it would be advantageous to include a polygenic effect since the accuracy will increase and bias decrease Whilst the accuracy of selection is a primary parameter of interest in animal ... evaluations in later generations, i.e after generation t = 1001 For each replicate, the mean and median of the Gibbs samples for the polygenic variance were calculated from the final 5000 As a...
... very popular because of the increasing number of international programs and international students (Huhta, Vartalla & Ervaala, 2007) Moreover, Huhta, Vartalla & Ervaala (2007) say that thesis ... from relevant materials, read few materials or read materials of low quality (Han, 2014) In addition, research question may not be addressed or remains unanswered (Huhta, Varttala & Ervaala, 2007) ... two participants reported that accessing reference materials of high quality was not easy because lots of articles asked for payment Two participants felt that analyzing and treating data which...
... the acquisition of data Beauchet, Allali, Herrmann, Kressig, Bridenbaugh, Assal, Dubost and Annweiler performed the analysis and interpretation of data Beauchet, Allali, Annweiler and Dubost was ... could be a particularly significant predictor of falls amongst frail older adults The lack of standardization in dual-task paradigms certainly explains many of the discrepancies listed above A consensus ... Conversation To carry a glass of water To carry a glass of water Conversation TUG Normal pace TUG Walking from home to an assessment room Normal pace Visuo-spatial decision task Arithmetic task...
... pleural biopsy, thoracentesis, or other Analysis Given that medical and surgical patients often have different complications and varying lengths of stay, the data for each were analyzed separately ... Cardiac arrest Sepsis Other Post-partum complications 10 Cardiovascular (congestive heart failure, cardiac arrest) Gastrointestinal complications* Other Sepsis Cardiovascular Gastrointestinal Gastrointestinal ... Hospital, a university-affiliated hospital, over a 6month period were enrolled and prospectively evaluated Because this was an observational study, no attempt was made to alter the performance of...
... toxicity of nedaplatin and 5-FU with radiation treatment for advanced esophageal carcinomas Anticancer Res 2003; 23: 3493-8 Yamada H, Maki H, Takeda Y, et al Evaluation of combined nedaplatin and ... Yamamori M, Kuwahara A, et al Pharmacokinetics and pharmacogenomics in esophageal cancer chemoradiotherapy Adv Drug Deliv Rev 2009; 61: 388-01 Miki I, Tamura T, Nakamura T, et al Circadian variability ... predictive of clinical outcome of chemoradiotherapy for stage II/III esophageal squamous cell carcinoma in Japanese Am J Clin Oncol 2007; 30: 252-7 Sakaeda T, Yamamori M, Kuwahara A, et al VEGF G-1154A...
... fractal (Jiang and Logan, 1991) The relationship between the mass and the size ofa fractal aggregate can be written as m∝lD, where l is the actual length of the aggregate and D is the fractal ... dimension A fractal aggregate with D
... gacccgatgttcaagatact ctcctcccacaaatcaggac Saito et al., 2003b QMF QMR QMT (Probe) agacgcacgctcacctcaa gagcagttcacgaaatcc atacgctcttactgtttccggccgcc in this study BACT1369F PROK1492R TM1389BACT2 ... blue-green algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura Environ.Tech., 14, 433-442 Park H.-D., Iwami C., Watanabe M F., Harada K.-I., Okino T and Hayashi H (1998) Temporal variabilities ... 61-72 Park H D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A and Kato K (2001) Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated from a hypertrophic lake...
... Health Association/American Water Works Association/Water Environment Federation, Washington DC, USA Tsuneda S., Nagano T., Hoshino T., Ejiri Y., Noda N and Hirata A (2003) Characterization of ... SVI gradually decreased due to aerobic granulation, as shown in Figs and As sludge settling ability increased, surface loading and aeration rates were gradually increased, and finally set at 1.8 ... Overhead view Fig - Schematic diagram of the AUFB reactor Reactor Setup and Operation for the Formation of Aerobic Granular Sludge Two AUFB reactors were used for the formation of aerobic granular...
... 2010 Seasonal Changes of Plankton and Submerged Macrophyte The genera of Anabaena, Merismopedia, Oscillatoria, Melosira, Cyclotella, Navicula, Gyrosigma, Chlamydomonas, Synura and Euglena were ... Standard Methods for the examination of water and wastewater, 20th edition, APHA, Washington Akiyama M (ed) (1996) Algae in Lakes Shinjiko and Nakaumi, Research Circle of Algae in Lakes Shinjiko and ... dominant genera were Euglena in March and Cyclotella in October Eight genera of zooplankton and protozoa such as Difflugia, Arcella, Stylonychia, Brachionus, Keratella, Monostyla, Asplanchna and...
... corporate tax rate, and an increase in the corporate tax rate can be compensated by a decrease in the wage tax rate Alternatively, the effect on the assignment decision of raising the wage tax rate ... lower wage tax rate, and an increase in the wage tax rate t j can be compensated by a decrease in the corporate tax rate τ j Similarly, for equal wage tax rates, the more productive agent is assigned ... between Austria and Germany 15 See Articles 15, 23 (2) of the Double Taxation Treaty between Croatia and Austria and Articles 15, 23 (2) of the Double Taxation Treaty between Croatia and Germany wage...
... types of chemical and hazardous wastes vary greatly, it is difficult to specify a typical analysis and generalize about the impacts of burning of chemical and hazardous waste Some researchers have ... historical data of the system for the day of the experiment and the day before Raw meal was analyzed for oxides and sulphur content whereas precalcined meal was analyzed for degree of calcination, ... heating value, bulk density and particle size distribution The proximate analysis was carried out using a Las Navas Automatic Multiple Sample Thermogravimetric Analyzer TGA-2000 by applying different...
... Transactions, vol 92, 1983, p 3.1086 [29] Arash Nemati, Shahram Khalilarya, Samad Jafarmadar, Hassan Khatamnejhad, Vahid Fathi Numerical parametric investigation ofa gasoline fuelled partially-premixed ... for baseline and adiabatic with EGR cases are the same Also at adiabatic case for 400°CA and 420°CA, these regions more spread out in the main chamber and the values of local peak temperature ... study of three operating conditions of engine: base line, adiabatic and also adding EGR to the initial charge of adiabatic case at two load operating conditions: a full load and a part load (50%...
... disposal of hazardous waste (co-disposal) Since the data available on the quantity, age, and composition of the refuse in the landfill are limited, using a more sophisticated calculation was not attempted ... dioxide are the major gases produced by biodegradation of landfill wastes [2-4, 7] According to Scheutz et al [2], the biodegradable organic material in waste includes paper, animal and vegetable matter, ... studies also indicate that the time since closure of the landfill is 42 years, the age of the landfill is 60 years, and the average annual waste acceptance rate is 1000 mg/year Given that this is a...