kahan cultural cognition as a conception of the cultural theory of risk

Reading Theory as a Microcosm of the Four Skills

Reading Theory as a Microcosm of the Four Skills

Ngày tải lên : 06/09/2013, 10:10
... teachers as they are the backbone of many schools in Ireland and Britain One of the most important initial tasks for any teacher is the task of knowing his clients The notion of needs analysis is absolutely ... central Even with as few details as we have outlined above, there are certain things that we can assume about this group First, given their age group, it is reasonable to assume that many of them ... constraints, at many different levels, on each occasion that they are called upon, they encourage a unique emphasis on particular combinations of strategies on each occasion In reading, the notions...
  • 5
  • 680
  • 0
Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx

Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx

Ngày tải lên : 13/02/2014, 05:20
... Subdivisions of Races Theories of monogenism and polygenism Doctrine of “geographical provinces” or “areas of characterization.” The continental areas at the date of man’s appearance on the earth Eurafrica, ... Eurafrica, Austafrica, Asia, America, Oceanica Causes and consequences of the migrations of races and nations a The Eurafrican Race.—Types of the white race Its first home Early migrations The South ... phonology of languages Universal alphabets Logical relations of the parts of speech The vocabulary and the grammar of languages Distinctions between languages and dialects Mixed languages and jargons...
  • 28
  • 665
  • 0
Tài liệu The Man of Letters as a Man of Business docx

Tài liệu The Man of Letters as a Man of Business docx

Ngày tải lên : 17/02/2014, 19:20
... of the Man of Letters as a Man of The Man of Letters as a Man of Business, by Business, I shall attract far more readers than I should in writing of him as an Artist Besides, as an artist he has ... often a lasting death An interesting proof of the value of the magazine to literature is the fact that a good novel will have wider acceptance as a book from having been a magazine serial I am ... sure that the case is in every way improved for young authors The magazines all maintain a staff for the careful examination of manuscripts, but as most of the material they print has been engaged,...
  • 21
  • 544
  • 0
Tài liệu Huntington’s Borghese Style Urn as a Study of Two-Dimensional Art & The Production of a Piece of Two-Dimensional Art pptx

Tài liệu Huntington’s Borghese Style Urn as a Study of Two-Dimensional Art & The Production of a Piece of Two-Dimensional Art pptx

Ngày tải lên : 19/02/2014, 10:20
... aesthetic The science of the “beautiful” in a work of art The aesthetic appeal of a work of art is defined by the visual Social, ethical moral, and contemporary standards of a society armature A ... Compare the "god-like" qualities of a particular character (such as Diana, goddess of the hunt) to a modern character (such as Mia Hamm, huntress of a soccer goal) The Huntington Library, Art ... side of a stick and two baseballs on the other—balancing out the picture balance A principal of art and design concerned with the arrangement of one or more elements in a work of art so that they...
  • 6
  • 681
  • 0
Smoking and reproduction: The oviduct as a target of cigarette smoke ppt

Smoking and reproduction: The oviduct as a target of cigarette smoke ppt

Ngày tải lên : 05/03/2014, 17:20
... had a picomolar LOAEL in the ciliary beat frequency assay Many of the compounds in Table were also screened using a chick chorioallantoic membrane (CAM) assay that measures growth of the CAM and ... oviduct: a regulator of local contraction and gamete transport J Cardiovasc Pharmacol 2004, 44 Suppl 1:S248-51 111 Wijayagunawardane MP, Miyamoto A, Taquahashi Y, Acosta TJ, Nishimura M, Sato K: Angiotensin ... femtomolar range (Table 1) In general, if a chemical were inhibitory, it acted in all three bioassays, although the potency and efficacy for a particular chemical varied among the assays Some of the...
  • 17
  • 733
  • 0
Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx

Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx

Ngày tải lên : 07/03/2014, 17:20
... Degradation of amino acid-substituted ASAs via the proteasome In order to investigate the degradation pathway of amino acid-substituted ASAs in the ER, we used Ltk– 1181 Arylsulfatase A degradation ... Pro136Leu, h) After the chase ASA was immunoprecipitated from the homogenates with the polyclonal ASA antiserum Precipitated ASA was quantified after SDS ⁄ PAGE with a bio-imaging analyser (Fujifilm) ... 25 after synthesis The maturation of these late forming epitopes is accompanied by a further maturation of epitopes A2 and A5 After 25 of chase, precipitation with mAbs A2 and A5 is almost as...
  • 10
  • 504
  • 0
Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt

Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt

Ngày tải lên : 08/03/2014, 10:20
... chains of Hb A0 was 10 times faster than that of the beta chains and that the oxidation of the beta chains was not influenced by pH The biphasic reaction was shown to consist of a rapid initial ... increased the initial fast phase of the reaction, but decreased the rate of the slow phase of oxidation in the presence of EDTA A comparison of rough and smooth LPSs of E coli and S minnesota in the ... general, the increase in the oxidation rate of crosslinked Hb mediated by LPSs is due to an increase in the rate of the initial fast phase, i.e oxidation of the a chains The rates of oxidation are...
  • 6
  • 748
  • 0
Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt

Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt

Ngày tải lên : 17/03/2014, 23:20
... aging A number of early explanations of aging, such as Orgel’s error catastrophe theory and the somatic mutation theory, were based on the idea that aging results from the accumulation of synthetic ... Mitochondrial free radical generation, oxidative stress, and aging Free Rad Biol Med 29, 222–230 44 Takasawa, M., Hayakawa, M., Sugiyama, S., Hattori, K., Ito, T & Ozawa, T (1993) Age-associated damage ... replicative advantage of human mtDNA carrying a point mutation that causes the MELAS encephalomyopathy Proc Natl Acad Sci USA 89, 11164–11168 49 Wallace, D.C (1997) Mitochondrial DNA in aging and disease...
  • 7
  • 444
  • 0
Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc

Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc

Ngày tải lên : 18/03/2014, 01:20
... In all cases, the optimal amount of arachidonic acid was determined and used to analyze the effect of S10 0A8 /A9 on oxidase activation After an incubation of 10 at 20 °C, the oxidase activity was ... an optimal amount of arachidonic acid determined for each assay of oxidase activation [12] The rate of O2– production by the activated NADPH oxidase was calculated from the rate of the superoxide ... NADPH oxidase activity was also assayed by polarographic measurement of the rate of O2 uptake at 20 °C with a Clark electrode at a voltage of 0.8 V All experiments were carried out at least twice...
  • 10
  • 396
  • 0
The welfare state as a determinant of women’s health: support for women’s quality of life in Canada and four comparison nations pptx

The welfare state as a determinant of women’s health: support for women’s quality of life in Canada and four comparison nations pptx

Ngày tải lên : 22/03/2014, 11:20
... 2000 from Statistics Canada (Statistics Canada, 2002) The data and analysis related to the availability and quality of childcare for Canadian women and those from the four comparisons nations comes ... Canada and four comparison nations, 2001 Canada Overall rank Seats in parliament (%) Female legislators, senior of cials, managers (%) Female professional and technical workers (%) Ratio female:male ... disabilities—is relatively low as compared to all nations except the US The low US rate may reflect the lack of available Table Reports of being a victim of crime as percentage of total population...
  • 17
  • 843
  • 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

Ngày tải lên : 23/03/2014, 05:22
... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... simultaneously with antitubulin (DM 1A) and anti-actin (lanes and 2) Other samples were stained with antineurofilament protein (lanes and 4) The volume of each sample was adjusted to load a similar amount...
  • 14
  • 416
  • 0
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx

A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx

Ngày tải lên : 28/03/2014, 20:20
... suggested that the basal ganglia, the area of neurological degeneration in those with PD, are specifically involved in the control of dance movements Increased activity in the basal ganglia was observed ... for their assistance with this study This work was supported by a grant from the Marian Chace Foundation to Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon ... questionnaire what they liked best and least about the program They greatly appreciated the camaraderie and socialization engendered by the program Being able to meet others with PD and their caregivers...
  • 19
  • 648
  • 0
Báo cáo Y học: Purification and characterization of the thyrotropin-releasing hormone (TRH)-degrading serum enzyme and its identification as a product of liver origin doc

Báo cáo Y học: Purification and characterization of the thyrotropin-releasing hormone (TRH)-degrading serum enzyme and its identification as a product of liver origin doc

Ngày tải lên : 31/03/2014, 21:21
... that the TRH-degrading enzyme (TRH-DE) is absent in the plasma of neonatal rats, whereas TRH is rapidly inactivated by plasma of adult rats [39] The endocrinological importance of this enzyme was ... Materials and methods TRH-degrading Lectin Brain enzyme Serum enzyme Liver enzyme SNA (Sambucus nigra A. ) GNA (Galanthus nivalis A. ) MAA (Maackia amurensis A. ) DSA (Datura stramonium A. ) ConA (Concanavalin ... conditions a molecular mass of 125 000 Da was estimated for the liver enzyme and the serum enzyme and a molecular mass of 116 000 Da for the brain enzyme, indicating that all these enzymes exist as homodimers,...
  • 9
  • 477
  • 0
Báo cáo sinh học: "An NIH intramural percubator as a model of academic-industry partnerships: from the beginning of life through the valley of death" pptx

Báo cáo sinh học: "An NIH intramural percubator as a model of academic-industry partnerships: from the beginning of life through the valley of death" pptx

Ngày tải lên : 18/06/2014, 19:20
... scenario may be an important feature of the percubator, particularly in light of today’s usual translational approach: a) academia hands off an application to the private sector only if and when ... respect to the needs of the market, which in turn will aid in assessing the translational potential of ideas that are still in the percolation phase The NIH intramural program is an ideal test site ... And as a practical matter, designating percubator investigators and their companies as ‘contractors and contract companies’ would be a simple route to initiating a pilot program in Bethesda as...
  • 4
  • 395
  • 0
báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx

báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx

Ngày tải lên : 18/06/2014, 22:20
... promoting quality of life in older adults The data were collected by Statistics Canada under the authority of the Statistics Act Access to the data was granted by Statistics Canada based on a peer-reviewed ... Statistics Canada Classification of chronic conditions The respondents were asked to indicate whether they had a disease or another health condition diagnosed by a health professional that had ... based on full information maximum likelihood estimation (FIML) (available in the Mplus 4.2 [30] software package) by using all available data to assess whether the estimates may have been biased...
  • 11
  • 619
  • 0
Báo cáo sinh học: " The Severe Acute Respiratory Syndrome (SARS)-coronavirus 3a protein may function as a modulator of the trafficking properties of the spike protein" docx

Báo cáo sinh học: " The Severe Acute Respiratory Syndrome (SARS)-coronavirus 3a protein may function as a modulator of the trafficking properties of the spike protein" docx

Ngày tải lên : 18/06/2014, 22:20
... also enhance virus packaging as it appears that the assembly of coronavirus occurs intracellularly, probably in the intermediate compartments between the endoplasmic reticulum and Golgi apparatus ... (diacidic) motif was found to be essential for the transport of 3a to the cell surface, consistent with the role of these motifs in the transportation of other proteins to the plasma membrane ... and enhance cellcell fusion, a process that is important for viral spreading Table shows a comparison of the amino acid sequences of the cytoplasmic tails of the S protein of different coronaviruses,...
  • 5
  • 310
  • 0
báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt

báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt

Ngày tải lên : 19/06/2014, 22:20
... microglial NADPH oxidase maybe largely responsible for the oxidative damage observed in the AD brain Astrocytes and the NADPH oxidase Astrocytes are the most abundant glial cell type in the brain and ... Shimohama S, Tanino H, Kawakami N, Okamura N, Kodama H, Yamaguchi T, Hayakawa T, Nunomura A, Chiba S, Perry G, Smith MA, Fujimoto S: Activation of NADPH oxidase in Alzheimer's disease brains Biochem ... complex and the initiation of intracellular signaling events regulating oxidase assembly and activation has been described [31,32] The NADPH oxidase The phagocytic NADPH oxidase plays an essential...
  • 12
  • 413
  • 0
báo cáo hóa học:" An NIH intramural percubator as a model of academic-industry partnerships: from the beginning of life through the valley of death" ppt

báo cáo hóa học:" An NIH intramural percubator as a model of academic-industry partnerships: from the beginning of life through the valley of death" ppt

Ngày tải lên : 20/06/2014, 03:20
... scenario may be an important feature of the percubator, particularly in light of today’s usual translational approach: a) academia hands off an application to the private sector only if and when ... respect to the needs of the market, which in turn will aid in assessing the translational potential of ideas that are still in the percolation phase The NIH intramural program is an ideal test site ... And as a practical matter, designating percubator investigators and their companies as ‘contractors and contract companies’ would be a simple route to initiating a pilot program in Bethesda as...
  • 4
  • 417
  • 0
báo cáo hóa học:" The Severe Acute Respiratory Syndrome (SARS)-coronavirus 3a protein may function as a modulator of the trafficking properties of the spike protein" docx

báo cáo hóa học:" The Severe Acute Respiratory Syndrome (SARS)-coronavirus 3a protein may function as a modulator of the trafficking properties of the spike protein" docx

Ngày tải lên : 20/06/2014, 04:20
... also enhance virus packaging as it appears that the assembly of coronavirus occurs intracellularly, probably in the intermediate compartments between the endoplasmic reticulum and Golgi apparatus ... (diacidic) motif was found to be essential for the transport of 3a to the cell surface, consistent with the role of these motifs in the transportation of other proteins to the plasma membrane ... and enhance cellcell fusion, a process that is important for viral spreading Table shows a comparison of the amino acid sequences of the cytoplasmic tails of the S protein of different coronaviruses,...
  • 5
  • 365
  • 0