0

jackie chi kit cheung and gerald penn

Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm

Ứng dụng chỉ thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơm

Nông - Lâm - Ngư

... mang gen thơm đồng hợp tử (chi m 17,4%).+ 91 dòng mang gen thơm dị hợp tử (chi m 21,7%) và 256 dòng không mang gen thơm (chi m 60,9%).Ứng dụng chi thị phân tử AND xác định gene phục ... dụng chi thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơmTRƯỜNG CAO ĐẲNG NÔNG LÂMKHOA CÔNG NGHỆ SINH HỌCBÀI THẢO LUẬN“Ứng dụng chi thị phân tử AND xác ... INSP: CTGGTAAAAAGATTATGGCTTCAỨng dụng chi thị phân tử AND xác định gene phục vụ chọn tạo giống lúa thơmỨng dụng chi thị phân tử AND xác định gene phục vụ chọn tạo...
  • 23
  • 1,187
  • 1
Evaluating the Reliability and Validity of an English Achievement Test for Third-year Non- major students at the University of Technology, Ho Chi Minh National University and some suggestions for chan

Evaluating the Reliability and Validity of an English Achievement Test for Third-year Non- major students at the University of Technology, Ho Chi Minh National University and some suggestions for chan

Thạc sĩ - Cao học

... kinds of achievement tests: final achievement test and progress achievement test.Final achievement tests are those administered at the end of a course of study. They may be written and administered ... essential and eligible testing technology. This is to evaluate learners’ ability, suitability of teaching methods, teaching/ learning materials and teaching/ learning conditions and suitability ... reliability and validity. Finally, in Section 2.4, the achievement test and its types are explored.2.1 The importance of testing in educationTesting is an important part of every teaching and leaning...
  • 38
  • 1,890
  • 13
Khảo sát một số chỉ tiêu lâm sàng huyết học và khả năng sinh sản của đàn nái sinh sản sau khi mắc hội chứng rối loạn hô hấp và sinh sản (porcine reproductive and respiratory syndrome)

Khảo sát một số chỉ tiêu lâm sàng huyết học và khả năng sinh sản của đàn nái sinh sản sau khi mắc hội chứng rối loạn hô hấp và sinh sản (porcine reproductive and respiratory syndrome)

Khoa học tự nhiên

... 60% là nước và 40% là vật chất khô, trong ñó Hemoglobin chi m 90 – 95%, còn 3 – 8% các protein khác: Leucoxitin chi m 0,5%, Cholesterol chi m 0,3%, các muối kim loại (chủ yếu là muối kali). Trong ... [5] căn cứ vào khả năng sinh sản và sức sản xuất thịt, ñã chia các giống lợn làm 4 nhóm chính: + Các giống ña dụng: Yorkshire, Landrace và một số dòng nguyên chủng ñược xếp vào loại có khả ... dụng “dòng bố”: Piétrain, Landrace (Bỉ), Duroc (Mỹ) có khả năng sinh sản trung bình nhưng khả năng sản xuất thịt cao + Các giống chuyên dụng “dòng mẹ”: Yorkshire, Landrace cải tiến ñặc biệt...
  • 84
  • 635
  • 0
Tài liệu CCIE 350-001 Routing and Switching Prep Kit pptx

Tài liệu CCIE 350-001 Routing and Switching Prep Kit pptx

Chứng chỉ quốc tế

... Decimal, and HexIt is important to understand how binary 1s and 0s are converted to decimals or hexcharacters. This is crucial to fully understand addressing, subnetting, and RIF reading, and many ... Table 1.3shows LAN interface types and the associated link speeds.03 2359 CH01 5.15.00 7:05 AM Page 19CCIE 350-001: Routing and Switching Prep Kit xii11 IGRP and EIGRP 209IGRP 210Stability ... ListsSimilar to IP Access Lists, IPX Standard lists filters based on network or node address.On the other hand, an IPX Standard Access List is different from an IP Standard AccessList because the IPX...
  • 540
  • 1,954
  • 0
Đánh giá đa dạng di truyền một số loài cây dược liệu việt nam thuộc chi đảng sâm (codonopsis sp) bằng kỹ thuật AND mã vạch

Đánh giá đa dạng di truyền một số loài cây dược liệu việt nam thuộc chi đảng sâm (codonopsis sp) bằng kỹ thuật AND mã vạch

Thạc sĩ - Cao học

... Tách chi t ADN tổng số Các mẫu thực vật được tách chi t lấy ADN tổng số bằng quy trình mini-CTAB và kit DNeasy® Plant Mini Kit của hãng Qiagen. 2.2.2. Kiểm tra sản phẩm ADN sau tách chi t ... mã vạch AND trên thực vật. Trình bày các phương pháp nghiên cứu: tách chi t AND tổng số; kiểm tra sản phẩm AND sau tách chi t; phương pháp nhân bản gen đích bằng kỹ thuật PCR; tinh sạch sảm ... 2012 Abstract. Tìm hiểu chi codonopsis; tổng quan về mã vạch AND (DNA barcode); một mã vạch AND được sử dụng rộng rãi và tình hình nghiên cứu; ứng dụng mã vạch AND trên thực vật. Trình bày...
  • 20
  • 975
  • 0
Xác định tên một số loài thuộc chi tre (bambusa schreb ) do biến đổi hình thái ở việt nam bằng kỹ thuật phân tích AND

Xác định tên một số loài thuộc chi tre (bambusa schreb ) do biến đổi hình thái ở việt nam bằng kỹ thuật phân tích AND

Thạc sĩ - Cao học

... Resources and Conservation Working. 55. Rao AN, Rao VR (1999), Bamboo and Rattan, Genetic Resources and Use, Proceedings of the third INBAR-IPGRI Biodiversity, Genetic Resources and Conservation ... ITS, GBSSI gene and plastid trnL-F ADN sequences, Molecular Phylogenetics and Evolution, 48(3), pp. 24-809. 68. Zhou MB, Lu JJ, Zhong H, Liu XM, Tang DQ (2010), Distribution and diversity ... loài thuc 25 chi tre trúc phân b t nhiên  Vit Nam [51]. Bảng 1.2. Hin trng tre trúc Vit Nam tính ti tháng 12/2004 [2] Các loại rừng tre trúc Din tích (ha) Phân chia theo chức...
  • 33
  • 683
  • 0
luyện thi đh kit 1 (đặng việt hùng) - mạch điện xoay chiều chỉ có hai phần tử (bài tập tự luyện)

luyện thi đh kit 1 (đặng việt hùng) - mạch điện xoay chiều chỉ có hai phần tử (bài tập tự luyện)

Vật lý

... áp xoay chi u u = 200sin(100πt + 3π/4) V thì biểu thức nào sau đây là của điện áp hai đầu cuộn cảm thuần ? Luyện thi đại học KIT- 1: Môn Vật Lí ( Thầy Đặng Việt Hùng) Mạch điện xoay chi u có ... điện áp xoay chi u vào hai đầu cuộn dây đến thời điểm t là A. 1/200 s B. 1/300 s C. 1/400 s D. 1/600 s Luyện thi đại học KIT- 1: Môn Vật Lí ( Thầy Đặng Việt Hùng) Mạch điện xoay chi u có hai ... Đoạn mạch điện xoay chi u gồm điện trở thuần R và tụ điện có điện dung C thì tổng trở của mạch là Luyện thi đại học KIT- 1: Môn Vật Lí ( Thầy Đặng Việt Hùng) Mạch điện xoay chi u có hai phần...
  • 8
  • 918
  • 30
luyện thi đh kit 1 (đặng việt hùng) - mạch điện xoay chiều chỉ có hai phần tử (tài liệu bài giảng)

luyện thi đh kit 1 (đặng việt hùng) - mạch điện xoay chiều chỉ có hai phần tử (tài liệu bài giảng)

Vật lý

... Luyn thi đi hc KIT- 1: Môn Vt Lí ( Thy ng Vit Hùng) Mch đin xoay chi u có hai phn t Hocmai.vn – Ngôi trng chung ca hc trò ... Giáo viên: ng Vit Hùng Ngun : Hocmai.vn Luyn thi đi hc KIT- 1: Môn Vt Lí ( Thy ng Vit Hùng) Mch đin xoay chi u có hai phn t Hocmai.vn – Ngôi trng chung ca hc trò ...    Ví d 2. Cho mch đin xoay chi u gm hai phn t R, L vi 1R 50 3, L (H).2 t vào hai đu đon mch mt đin áp xoay chi u có biu thc u = 120cos(100t + /4) V....
  • 6
  • 571
  • 8
luyện thi đh kit 1 (đặng việt hùng) - mạch điện xoay chiều chỉ có một phần tử (bài tập tự luyện)

luyện thi đh kit 1 (đặng việt hùng) - mạch điện xoay chiều chỉ có một phần tử (bài tập tự luyện)

Vật lý

... xoay chi u ch có đin tr thun R? A. Dòng đin xoay chi u chy qua đin tr luôn có pha ban ban đu bng không. B. Dòng đin xoay chi u chy qua đin tr luôn cùng pha vi đin áp xoay chi u ... dòng đin xoay chi u qua nó. B. t l thun vi hiu đin th hai đu t. C. t l nghch vi cng đ dòng đin xoay chi u qua nó. D. có giá tr nh nhau đi vi c dòng xoay chi u và dòng ... 74. Mt mch đin xoay chi u ch có cun thun cm, mi quan h v pha ca u và i trong mch là Luyn thi đi hc KIT- 1: Môn Vt Lí ( Thy ng Vit Hùng) Mch đin xoay chi u có mt phn t...
  • 10
  • 750
  • 21
luyện thi đh kit 1 (đặng việt hùng) - mạch điện xoay chiều chỉ có một phần tử (tài liệu bài giảng)

luyện thi đh kit 1 (đặng việt hùng) - mạch điện xoay chiều chỉ có một phần tử (tài liệu bài giảng)

Vật lý

... Luyn thi đi hc KIT- 1: Môn Vt Lí ( Thy ng Vit Hùng) Mch đin xoay chi u có mt phn t Hocmai.vn – Ngôi trng chung ca hc trò ... uuuii     Câu 7. Mch đin xoay chi u ch có t đin vi đin dung C. t vào hai đu t đin mt đin áp xoay chi u có biu thc u = Uocos(t + ) V. Cng đ dòng ... ch có t đin có đin dung 410C (F) mt đin áp xoay chi u có biu thc  u 200cos 100t /6 V. Dòng đin xoay chi u chy qua đon mch có biu thc A. i 2cos 100t A.3...
  • 10
  • 584
  • 14
Tài liệu Vivaldi and the Four Seasons TEACHER RESOURCE KIT potx

Tài liệu Vivaldi and the Four Seasons TEACHER RESOURCE KIT potx

Kỹ năng nghe tiếng Anh

... to come and settle in New France (Canada) between 1665 and 1672. Thousands of young, teenaged women were given clothing, money, and room and board in the hopes that they would marry and begin ... is right.” And he was pleased.Vivaldi and The Four SeasonsC.J. TAYLOR is an internationally acclaimed artist and children’s author of Mohawk heritage. She is a self-taughtartist and storyteller ... cells, and much more. William Harvey discovered the circulation of blood.There were many great composers too: in Germany there were Bach and Telemann;Handel and Purcell worked in England; France...
  • 34
  • 590
  • 1
Nokia Car Kit CK-100 User and Installation Guide pdf

Nokia Car Kit CK-100 User and Installation Guide pdf

Kĩ thuật Viễn thông

... service facility for the car kit to be serviced.Introduction51. IntroductionWith the Nokia Car Kit CK-100, you can conveniently make and answer calls hands-free and listen to music from your ... phone and music device (if any) from the car kit. See “Disconnect the car kit, ” p. 10. The car kit automatically switches off after 2 minutes.• Turn the Navi wheel to the left until the car kit ... Bluetooth profile and another device supporting the A2DP Bluetooth profile at a time.Pair and connect the car kit If your phone supports the HFP and A2DP Bluetooth profiles and has a music...
  • 30
  • 1,176
  • 0
THE PENNSYLVANIA MARCELLUS NATURAL GAS INDUSTRY: STATUS, ECONOMIC IMPACTS AND FUTURE POTENTIAL potx

THE PENNSYLVANIA MARCELLUS NATURAL GAS INDUSTRY: STATUS, ECONOMIC IMPACTS AND FUTURE POTENTIAL potx

Cao đẳng - Đại học

... business-to-business spending and how lease and bonus payments and royalties are spent by land owners and how this spending affects business activity. Exploring, drilling, processing, and transporting natural ... Marcellus industry purchases of goods and services, their royalties to landowners, and tax payments directly create more than 67,000 jobs in Pennsylvania. When indirect and induced impacts are considered, ... equivalent emissions in the Pennsylvanian economy. Carbon emissions, therefore, are endogenous and depend upon energy prices and economic activity driving energy demand and the choice of electricity...
  • 68
  • 305
  • 0
Minimum Wages and Employment: A Case Study of the Fast-Food Industry in New Jersey and Pennsylvania pot

Minimum Wages and Employment: A Case Study of the Fast-Food Industry in New Jersey and Pennsylvania pot

Cao đẳng - Đại học

... employment, wages, and prices at stores Charles Brown, Richard Lester, Gary Solon, two anonymous referees, and seminar participants at in New Jersey and Pennsylvania before and Princeton, Michigan State, ... employment and starting wages in waves 1 and 2. The dependent variable in all models is change in FTE employment. The mean and standard deviation of the dependent variable are -0.237 and 8.825, ... in New Jersey, Pennsylvania, and New York all trended upward between 1991 and 1993, with a larger increase in New Jersey than Pennsylvania during 1992. Since sales of franchised fast-food...
  • 26
  • 869
  • 0

Xem thêm