it apos s essential that there be a limited number of licenses offered

Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

Ngày tải lên : 16/03/2014, 00:20
... proteome was analyzed by means of 2D-PAGE and MS This analysis revealed a similar pattern of responses to both sublethal and lethal peptide doses, consisting of only a few significant variations in ... experiments have underscored the fact that Esc(1–18) possesses a wide spectrum of antimicrobial activity against several species of Grampositive bacteria, Gram-negative bacteria, Candida and multidrug-resistant ... time intervals, and b-lactamase activity was detected as described above and expressed as percentage of the total obtained after cell lysis Data are the means ± standard deviations of three independent...
  • 18
  • 494
  • 0
Estimating Inflation Expectations with a Limited Number of Inflation-Indexed Bonds ∗ doc

Estimating Inflation Expectations with a Limited Number of Inflation-Indexed Bonds ∗ doc

Ngày tải lên : 15/03/2014, 07:20
... expectations, and as such we implicitly assume that liquidity premia are included in our measure of risk premia We also assume that the existence of liquidity premia causes a level shift in estimated ... The mean and variance of the data forecasts are then used to update the estimates of the state and its variance The algorithm we use is that of an additive-noise central difference Kalman filter, ... measurement equations (functions H1(xt ) and H2(xt )) are used to calculate a set of forecast observation points This set of points is used to estimate a mean and variance of the data forecasts...
  • 32
  • 347
  • 0
RESEARCH DISCUSSION PAPER: Estimating Infl ation Expectations with a Limited Number of Infl ation-indexed Bonds doc

RESEARCH DISCUSSION PAPER: Estimating Infl ation Expectations with a Limited Number of Infl ation-indexed Bonds doc

Ngày tải lên : 22/03/2014, 20:20
... estimate a mean and variance of the data forecasts • The mean and variance of the data forecasts are then used to update the estimates of the state and its variance The algorithm we use is that of an ... economists’ forecasts These findings are consistent with those of Kim and Orphanides (2005), where the use of forecast data is advocated as a means of separating expectations from risk premia Note, ... this paper are those of the authors and are not necessarily those of the Reserve Bank of Australia Author: finlayr at domain rba.gov.au Media Of ce: rbainfo@rba.gov.au Abstract We estimate inflation...
  • 39
  • 395
  • 0
Fixed Deposit Accounts: Accounts that give you a fixed rate of interest for a defined term. potx

Fixed Deposit Accounts: Accounts that give you a fixed rate of interest for a defined term. potx

Ngày tải lên : 29/03/2014, 01:20
... would be if interest was paid and compounded each year Our Annual Equivalent Rate (AER) calculation assumes that the account is held for a year and that the interest rate remains constant Deposit ... the start of business on 18th September 2012 The following accounts are not available for new applicants Instant Access Deposit Account e0.01 plus Classic Quarterly Account Gross Rate % AER% ... illustrates what the interest would be if interest was paid and compounded each year Our AER calculation assumes that the account is held for a year and that the interest rate remains constant...
  • 5
  • 433
  • 0
The Rise and Fall of the U.S. Mortgage and Credit Markets: A Comprehensive Analysis of the Meltdown pot

The Rise and Fall of the U.S. Mortgage and Credit Markets: A Comprehensive Analysis of the Meltdown pot

Ngày tải lên : 29/03/2014, 07:20
... initially must be auto loans, student loans, credit card loans, or small business loans guaranteed by the U .S Small Business Administration All U .S persons that own eligible collateral may participate ... financial systems This also requires a reassessment of whether there should be a supranational regulator or whether bigger roles should be assigned to international organizations such as the Basel ... on- and off-balance-sheet activities allowed by banks to ensure adequate liquidity, capital, and duration match of assets and liabilities A balance must be struck to allow banks to be competitive...
  • 51
  • 467
  • 0
Báo cáo toán học: " Could petroleum biodegradation be a joint achievement of aerobic and anaerobic microrganisms in deep sea reservoirs?" pptx

Báo cáo toán học: " Could petroleum biodegradation be a joint achievement of aerobic and anaerobic microrganisms in deep sea reservoirs?" pptx

Ngày tải lên : 20/06/2014, 21:20
... previously described by da Cruz et al (2008) Gas aliquots were removed every 30 days and the headspace composition was analyzed using gas chromatography-mass spectrometry (GC-MS) The amount of dissolved ... well as environmental clones, available at the public databases Genbank and the RDP (Ribosomal Database Project, Wiscosin, USA) by using BLASTn and RDP sequence match routines Sequences were aligned ... Structural and stratigraphic evolution of the Campos Basin, Offshore Brazil In: Extentional Tectonics and Stratigraphy of North Atlantic Margins, American Asssociation of Petroleum Geologists,...
  • 32
  • 450
  • 0
How to be a good steward of energy and the environment potx

How to be a good steward of energy and the environment potx

Ngày tải lên : 29/06/2014, 04:20
... consequences of our actions That s not to say this is a good thing, just that it s a reality we’ll always have to deal with it s not something the human race will someday escape These statements may be ... consensus There s plenty of debate and no consensus on the other stuff.3 Of course, the climate is always changing, sometimes drastically As it happens, the past several thousand years of recorded ... for Data Analysis heritage.org future similar attempts to restrict carbon emissions by fiat.8 Some Fake Solutions: Cap and Trade and Its Cousins Unlike plans that are frankly designed to restrict...
  • 15
  • 462
  • 0
Báo cáo hóa học: " Application of Evolution Strategies to the Design of Tracking Filters with a Large Number of Specifications" potx

Báo cáo hóa học: " Application of Evolution Strategies to the Design of Tracking Filters with a Large Number of Specifications" potx

Ngày tải lên : 23/06/2014, 00:20
... amount of figures, an area is defined in which the performance is described by a limited amount of parameters and some simple relations Besides, since ARTAS will provide radar data processing basically ... Universidad Carlos III de Madrid in 2000 Since 2002, he has been there as an Assistant Professor of automata theory and programming language translation His main research topics are evolutionary ... RMS values of errors, evaluated through Monte Carlo simulation, and ARTAS specifications for all scenarios and magnitudes, as will be detailed next It is important to notice that simulations are...
  • 14
  • 342
  • 0
Báo cáo toán học: "An Asymptotic Expansion for the Number of Permutations with a Certain Number of Inversions" docx

Báo cáo toán học: "An Asymptotic Expansion for the Number of Permutations with a Certain Number of Inversions" docx

Ngày tải lên : 07/08/2014, 06:20
... a substantially improved paper the electronic journal of combinatorics (2000), #R50 11 References [1] M Abramowitz and I .A Stegun, Eds., Handbook of Mathematical Functions with Formulas, Graphs ... real numbers x Our result follows since, apart from the error term, the smallest term in (29) has order of magnitude at least n−m−1 for x2 = x2 (n) ≤ ln n As a consequence of Theorem 3, we have a ... n is even See Corollaries 2, for other asymptotic expansions In what follows, k, and n are integers with ≤ k ≤ n and ≤ ≤ n We denote the nonnegative integers by N All asymptotic formulas are...
  • 11
  • 348
  • 0
Báo cáo y học: "Lack of association of a variable number of aspartic acid residues in the asporin gene with osteoarthritis susceptibility: case-control studies in Spanish Caucasians" potx

Báo cáo y học: "Lack of association of a variable number of aspartic acid residues in the asporin gene with osteoarthritis susceptibility: case-control studies in Spanish Caucasians" potx

Ngày tải lên : 09/08/2014, 07:20
... the ASPN microsatellite is not associated with OA susceptibility in European Caucasians Discrepancies between the Japanese and Caucasians could be multifactorial, involving differences in disease ... this study and a review of the clinical history and a review of radiographs Analysis of synovial fluid was not a requisite Obesity and occupational strain were not considered exclusion causes Patients ... Spanish Caucasians This result reinforces the overall lack of association reported in other studies in Caucasians The association between variation in the number of D residues and OA described...
  • 4
  • 431
  • 0
Báo cáo sinh học: "An approximate theory of selection assuming a finite number of quantitative trait loci" docx

Báo cáo sinh học: "An approximate theory of selection assuming a finite number of quantitative trait loci" docx

Ngày tải lên : 09/08/2014, 18:21
... ensures that the distribution of breeding values is Gaussian, and validates the whole statistical apparatus that made the statistical developments of applied quantitative genetics possible and its ... values of L as small as A similar analysis can be carried out for the model assuming a constant environmental variance, rather than a constant phenotypic variance = DISCUSSION The preceding calculations ... Unless the size of the population is quite small and selection intensity is high, it is seen that L is slowly varying; at least, comparison e with figure indicates that this parameter changes with...
  • 22
  • 186
  • 0
Báo cáo sinh học: "An FPT haplotyping algorithm on pedigrees with a small number of sites" ppsx

Báo cáo sinh học: "An FPT haplotyping algorithm on pedigrees with a small number of sites" ppsx

Ngày tải lên : 12/08/2014, 17:20
... events This result extends our prior work for pedigrees with two sites to an arbitrary small number of sites Preliminaries A member is an individual A set of members is called a family if it includes ... haplotype A specific location in a chromosome is called a site and its state is called an allele There are two main types of sites, microsatellites and single nucleotide polymorphisms A microsatellite ... microsatellite site has several different states while a single nucleotide polymorphism (SNP) site has exactly two possible states, denoted by and Only SNPs with two possible states are considered...
  • 8
  • 241
  • 0
Báo cáo y học: "Identification of 491 proteins in the tear fluid proteome reveals a large number of proteases and protease inhibitors" pot

Báo cáo y học: "Identification of 491 proteins in the tear fluid proteome reveals a large number of proteases and protease inhibitors" pot

Ngày tải lên : 14/08/2014, 17:22
... de Souza et al LTQ-Orbitrap The mass spectrometer was operated in the data-dependent mode to automatically switch between Orbitrap-MS and Orbitrap-MS/MS (MS2) acquisition Survey full scan MS spectra ... hydrolase GO classification group is very broad, involving several processes, such as signal transduction (phosphatases), energy-driven reactions (ATPases), and glycolysis We selected from this group ... 12% of the total number of proteins described) belong to the functional group of hydrolase activity or protease inhibitors It has been demonstrated that the levels of proteases and proteases inhibitors...
  • 11
  • 289
  • 0
Báo cáo khoa học: It’s cheap to be colorful Anthozoans show a slow turnover of GFP-like proteins potx

Báo cáo khoa học: It’s cheap to be colorful Anthozoans show a slow turnover of GFP-like proteins potx

Ngày tải lên : 30/03/2014, 09:20
... the scleractinian corals M cavernosa, Scolymia cubensis, Catalaphyllia jardinei, the corallimorpharian Ricordia florida and the alcyonarian Dendronepthya sp [10,12,27] An unusual, green-to-orange ... average spectra and standard deviations for 12 independent measurements (C) Immunoblot analysis of the red-emitting form of mcavRFP Average optical density and standard deviations were calculated ... fluorescence of the colonies was excited by using a hand-held blue light lamp (Nightsea, Andover, MA) or a metal halide lamp (Osram, Danvers, MA) equipped with a 530 nm bandpass filter glass (Schott,...
  • 10
  • 487
  • 0
101 reasons why it’s great to be a woman

101 reasons why it’s great to be a woman

Ngày tải lên : 01/03/2015, 07:54
... must still be chivalrous Ladies first Always 37 101 Reasons why it' s great to be a Woman.pmd 37 11/01/2007, 10:00 101 REASONS WHY IT S GREAT TO BE A WOMAN Horoscopes in women s magazines always ... REASONS WHY IT S GREAT TO BE A WOMAN We can demand pressies, chocolate and flowers to settle a disagreement Men are lazy and fancy the easy way out 15 101 Reasons why it' s great to be a Woman.pmd ... Edited by Elizabeth Kershaw Cartoons by Annie Houseman 101 Reasons why it' s great to be a Woman.pmd 11/01/2007, 10:00 Reasons Why It s Great To Be A Woman SUMMERSDALE 101 Reasons why it' s great...
  • 128
  • 261
  • 0
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

Ngày tải lên : 26/10/2012, 10:04
... and its association with essential hypertension and left ventricular hypertrophy in the Japanese Circ Res 2000; 86: 841-5 13 Nakayama T, Soma M, Rahmutula D, Ozawa Y, Kanmatsuse K Isolation of ... parameters were set according to the manufacturer s protocol Sequencing analysis Two oligonucleotides (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA ... (χ2) analysis Differences in the clinical data between the EH and NT groups were assessed by analysis of variance (ANOVA) The distributions of 148 the genotypes or alleles between EH patients and...
  • 7
  • 612
  • 1
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Ngày tải lên : 15/02/2014, 01:20
... in Table Bacterial strains, plasmids and growth conditions The bacterial strains and plasmids used in this study are detailed in Table Paracoccus pantotrophus strains were grown in Luria–Bertani ... periplasm In the case of P pantotrophus it would be the substrate for NirF that is translocated In either case the transport process is enigmatic as none of the Nir proteins codes for a transmembrane ... but accessing these putative substrates is not trivial An alternative approach would be to seek accumulation of the substrate of NirF in a mutant that lacks NirF; this too is not trivial as the...
  • 12
  • 613
  • 0
TOWARDS A CARIBBEAN CINEMA - CAN THERE BE OR IS THERE A CARIBBEAN CINEMA? ppt

TOWARDS A CARIBBEAN CINEMA - CAN THERE BE OR IS THERE A CARIBBEAN CINEMA? ppt

Ngày tải lên : 07/03/2014, 15:20
... been assumed to be a person of African descent On the contrary, the Caribbean is made up of Africans, East Indians, Asians, White Europeans and descendants of Native Americans (the Caribs and Arawaks) ... he/she makes films; and the issue of content of those films that are to be considered Caribbean Christian Lara puts forward a definition of Caribbean cinema as one that addresses the nationality ... Associate Professor of Film Studies Raymond Tymas-Jones Dean, College of Fine Arts SAMPSON, DESIREE M .A August 2004 Film Studies Towards a Caribbean Cinema - Can there be or is there a Caribbean...
  • 89
  • 557
  • 0