it apos s easy to write a never ending program
Using Your Sybex Electronic Book pot
... commands, which lead to submenus Notice that most menus can also be displayed as toolbars Also, not all options are available at all times The options that cannot possibly apply to the current state ... of applications: Windows applications, Web applications, classes and custom controls, even console applications It provides numerous tools for automating the development process, visual tools to ... you design a form visually and appears when you switch to the code editor View White Space Space characters (necessary to indent lines of code and make it easy to read) are replaced by periods Word...
- 1,100
- 1,204
- 0
Tài liệu Báo cáo khoa học: "Parsing, Projecting & Prototypes: Repurposing Linguistic Data on the Web" doc
... Enhancing ODIN s Value to Computational Linguistics: Search and Language Profiles ODIN provides a variety of ways to search across its data, in particular, search by language name or code, language ... (where sufficient citation information exists and where the data is relatively clean) or locate documents in which the data exists Additional search facilities allow users to search across potentially ... documents Following linguistic custom and fair use restrictions, only instances of data that have citations are displayed An example is shown in Figure Search by language and name is by far the most...
- 4
- 432
- 0
Báo cáo y học: " Publishing Chinese medicine knowledge as Linked Data on the Web" pdf
... Diseasome database to search for the diseases associated with these genes If an RDF-TCM gene is also associated with the Alzheimer s disease according to Diseasome, we then confirm that gene as ... the datasets The other issue related to relational database integration is that often no programmatic access is provided for these databases and only a data dump is available Linked Data on the ... of links is to associate drugs from dataset D1 with genes from dataset D2 through a property such as ex:targets Properties such as owl: sameAs or rdfs:seeAlso can be used for stating identity reconciliation...
- 12
- 283
- 0
Tài liệu Module 6: Manipulating XML Data on the Client Using DOM doc
... This lab asks students to apply a style sheet to the “book” data island in order to transform it into a suitable format to add to the “order” data island The style sheet that performs the transformation ... Vijayalakshmi Narayanaswamy (NIIT) Subject Matter Experts: Andy Olsen (QA Training), Andy Longshaw (Content Masters) Content Lead: Janet Robinson Graphic Artist: Scott Serna (Creative Assets) ... XML Data on the Client This lab asks students to use DOM to add more details to the “order” data island There are many opportunities for students to go astray with the syntax, so keep a close eye...
- 80
- 502
- 0
Tài liệu How To Acquire Customers On The Web pptx
... set up shop, attention shifted to banner ads as a way to attract traffic Like many e-tailers, CDnow initially saw banner ads as a great way to promote its site to Web surfers But many of those ... customer acquisition averages out to less than the total average lifetime value of its customers Because the costs of such programs as the Cosmic Music Network are so very low, the total customer acquisition ... goods generated through their storefronts Critical to the success of revenue-sharing programs is their lack of exclusivity Most affiliate programs are open to any site that wishes to participate...
- 8
- 568
- 0
Tài liệu Module 11: Accessing Data from the Outlook 2000 Client ppt
... Web-based applications It is somewhat harder to that with a C-based LDAP API ADSI and ADO ADO is an Automation server that exposes a high-level set of database programming objects to the Visual Basic, ... administrative tasks, it is best to use ADSI ADSI has the ability to access and update the Exchange directory, as well as other directory services Function of ADSI ADSI is a set of specifications of ... AddressList object is an address book that contains a set of AddressEntry objects For instance, the Personal Address Book is an AddressList object The AddressList object supplies a list of address...
- 62
- 398
- 0
Tài liệu Báo cáo khoa học: "Learning to Find Translations and Transliterations on the Web" doc
... English phrases and a 133 Automatic Evaluation Manual Evaluation Evaluation based on exact match against a single reference answer leads to under-estimation, because an English phrase is often translated ... translations for a given term on the Web, a promising approach is automatically learning to extract phrasal translations or transliterations of phrase based on machine learning, or more specifically ... returned as the output of the system 3.1 Preparing Data for CRF Classifier We make use a small set of term and translation pairs as seed data to retrieve and annotate mixedcode snippets from a search...
- 5
- 531
- 1
Tài liệu Báo cáo khoa học: "Names and Similarities on the Web: Fact Extraction in the Fast Lane" ppt
... validation and ranking of candidate facts, based on a similarity measure of each candidate fact relative to the set of seed facts Whereas previous studies assume clean text collections such as news corpora ... candidate facts Candidate facts Validation of patterns Occurrences of extraction patterns Validation of candidate facts Validated candidate facts Validated extraction patterns Scoring and ranking ... contain many classes (e.g., chairman and CEO) but very few instances such as Osasuna, Crewe etc., the patterns containing an instance rather than a class will not be found to be similar to one another...
- 8
- 488
- 0
Tài liệu Báo cáo khoa học: "Organizing Encyclopedic Knowledge based on the Web and its Application to Question Answering" ppt
... Linguistics, pages 189–196 Yuji Matsumoto, Akira Kitauchi, Tatsuo Yamashita, Yoshitaka Hirano, Osamu Imaichi, and Tomoaki Imamura 1997 Japanese morphological analysis system ChaSen manual Technical Report ... descriptions based on domains (and consequently word senses) In addition, we proposed a question answering system, which answers interrogative questions associated with what, by using a Web-based encyclopedia ... extract a page fragment as a term description Since term descriptions usually consist of a logical segment (such as a paragraph) rather than a single sentence, we extract a fragment that matched...
- 8
- 508
- 1
Báo cáo khoa học: Phytoene synthase genes in tomato (Solanum lycopersicum L.) – new data on the structures, the deduced amino acid sequences and the expression patterns doc
... CCTCGATGAATCAAAAAAACGG TCATGGAATCAGTCCGGGAGGGAA AGGCAAGGCTGGAAGATATTTTT GAAACAGTGTCGGATAAAGCTGC ACGGGCGGCCATTTGATATGCTTG GGCCATTGTTGAAAGAGAGG TCATGCTTTATCTTTGAAGAGAGG TCTCTACGTGTATCAAAGGTAGTAAGG ... TaqMan-Le1 8s- 140 Psy1F312 Psy1R381 TaqManPsy1 Psy2F952 Psy2R1024 TaqManPsy2 PSY1For21 PSY1Rev1522 PSY2For27 PSY2Rev1674 GAAACGGCTACCACATCCAAG CCCCGTGTTAGGATTGGGT AAGGCAGCAGGCGCGCAAA TGACGTCTCAAATGGGACAAGT ... carotenoids as secondary metabolites in the pigmentation of tomato flowers and fruits has been also reanalysed in the light of these results 528 Results Isolation of tomato Psy1 and Psy2 genes Using...
- 9
- 607
- 0
Báo cáo khoa học: "A DOM Tree Alignment Model for Mining Parallel Data from the Web" doc
... Parallel Sentences As we know, the absolute value of mining system recall is hard to estimate because it is impractical to evaluate all the parallel data held by a bilingual website Instead, we compare ... exact parallel, (ii) roughly parallel: two parallel sentences involving missing words or erroneous additions; (iii) not parallel Two annotators are 494 assigned for this task with cross-validation ... taken from our mining results All parallel sentence pairs in these document pairs are manually annotated by two annotators with crossvalidation We have compared sentence alignment accuracy with...
- 8
- 435
- 0
Báo cáo khoa học: "Tools for Multilingual Grammar-Based Translation on the Web" docx
... reviews of restaurants in three languages (English, Spanish, and Swedish) Any change made in any of the languages gets automatically translated to the other languages To take an example, the OWL -to- GF ... individual languages, separate for each pair of languages Being interlingua-based, GF translation scales up linearly to new languages without the quadratic blowup of transfer-based systems In transfer-based ... syntax to the 15 languages currently available in the GF Resource Grammar Library smaller scale as regards languages and application domains A running demo system is available at http: //grammaticalframework.org:41296...
- 6
- 552
- 0
Business models on the web(c) M.Civilka, 2002 doc
... of each sale on a pertransaction basis (c) M.Civilka Distributor A catalog-type operation B2B models are increasingly common Broker facilitates business transactions between franchised distributors ... [ex: Yahoo! Stores, Stuff.com, ChoiceMall, ExciteStores] (c) M.Civilka Metamediary A business that brings buyers and online merchants together and provides transaction services It is a virtual ... offer/negotiated buy, or an auction offer/bid approach (c) M.Civilka Business Trading Community It is as a site that acts as an "essential, comprehensive source of information and dialogue for a particular...
- 49
- 313
- 0
Testing Applications on the Web: Test Planning for Mobile and Internet-Based Systems pdf
... Partitioning and Boundary Condition Analysis State Transition Use Cases Example Test Cases from Use Cases Test Cases Built from Use Cases Templates for Use-Case Diagram, Text, and Test Case Condition ... software quality engineers, quality assurance staff, test managers, project managers, IT managers, business and system analysts, and anyone who has the responsibility of planning and managing ... 11:14 AM Page xii Contents Chapter 14 Database Tests Why Read This Chapter? Introduction Relational Database Servers Structured Query Language Database Producers and Standards Database Extensions...
- 674
- 2,051
- 15
Báo cáo khoa học: "Extracting Paraphrases from Definition Sentences on the Web" pptx
... (2001) Basically, this approach assumes that two expressions that have a large distributional similarity are paraphrases There are also variants of this approach that address entailment acquisition ... by paraphrase classifier The paraphrase checking of candidate phrase pairs is performed by an SVM classifier with a linear kernel that classifies each pair of candidate phrases into a paraphrase ... candidate Paraphrase candidates are ranked according to an unsupervised scoring scheme that implements their assumption They assume that a paraphrase candidate tends to be a valid paraphrase if it...
- 11
- 439
- 0
Báo cáo khoa học: " A Cooperative Question-Answering System on the WEB" pdf
... Systems (KBCS), Mumbai, India, dec Chakravarthy U, Grant J, and Minker J 1990 LogicBased Approach to Semantic Query Optimisation, ACM Transactions on Database Systems, 15(2):162207, 1990 Gaasterland ... Frequently Asked Questions (FAQ) section of a number of web services, among which services dedicated to tourism This corpus also defines a small but representative subset of question types that characterize ... the system cannot find any response Finally, intentional responses may be provided instead of a large set of extensional answers An overview of these aspects is given in (Gaasterland et al, 94)...
- 4
- 339
- 0
Báo cáo khoa học: "Language ID in the Context of Harvesting Language Data off the Web" ppt
... language ID task can be treated as a classification problem A classifier is a function that maps Table 3: Various language name tables a training/test instance x to a class label y, and y Language ... language ID task shares many similarities with a typical coreference resolution task For instance, language names are similar to proper nouns in that they are often unambiguous IGT instances are ... these additional documents are processed, the database is expected to expand significantly ODIN is a valuable resource for linguists, as it can be searched for IGTs that belong to a particular language...
- 9
- 397
- 0
testing applications on the web
... Partitioning and Boundary Condition Analysis State Transition Use Cases Example Test Cases from Use Cases Test Cases Built from Use Cases Templates for Use-Case Diagram, Text, and Test Case Condition ... software quality engineers, quality assurance staff, test managers, project managers, IT managers, business and system analysts, and anyone who has the responsibility of planning and managing ... 11:14 AM Page xii Contents Chapter 14 Database Tests Why Read This Chapter? Introduction Relational Database Servers Structured Query Language Database Producers and Standards Database Extensions...
- 674
- 1,138
- 2
thinking on the web berners-lee, godel and turing
... (nodes) were added, and as new capabilities and features were introduced, such as software and protocols to facilitate email and file transfers Although the ARPANET was originally designed to allow ... and ontology languages and offers automated processing through machine-understandable metadata Semantic Web agents could utilize metadata, ontologies, and logic to carry out its tasks Agents are ... moved a6 and said, “Suppose most of the chess player s skill actually comes from an ability to compare the current position against images of thousands of positions already studied We would call selecting...
- 292
- 358
- 0
The Insider’s Guide Customer Service on the Web ppt
... operator or salesperson • eliminates 66% of manual email support tasks by posting answers to customers' most commonly asked questions in an easy- to- navigate support area • achieves measurably ... web to buy, sell, recruit staff, solicit bids and make referrals It' s also a great place to support customers and forge closer relationships with them That means it' s also a great place to lose ... users Call center operators had to answer repetitive questions as simple as, "What 's an IP address?" Because of the technical sophistication of Allied s operators, support calls cost the company...
- 15
- 371
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25