0

is there a role for hypoglycemic drugs and or antioxidants

Báo cáo khoa học:

Báo cáo khoa học: "Postmastectomy irradiation in breast in breast cancer patients with T1-2 and 1-3 positive axillary lymph nodes: Is there a role for radiation therapy" ppsx

Báo cáo khoa học

... http://www.ro-journal.com/content/6/1/28 Page of Table The impact of clinical and pathologic factors on the overall survival Factors Assessed Univariate Analysis Multivariate Analysis Hazard Ratio 95% CIa pb Hazard Ratio 95% ... DMe Alive DM Death DM Death DM Death DM Death DM Alive Out-come a Lateral, bMedial, cInvasive ductal carcinoma, dInvasive Paget’s disease, eDistance metastasis patients had lung metastasis and ... as DM Statistical Analysis LRR and DM rates were calculated by first event analysis If a distant metastasis developed, then subsequent local failures were censored (vice versa) years actuarial...
  • 8
  • 357
  • 0
is there a future for quantum chemistry

is there a future for quantum chemistry

Hóa học - Dầu khí

... to assist in solving chemical problems Quantum Mechanics Molelcular Orbital Theory Density Functional Theory Ab Initio Calculations Statistical Mechanics Molecular Dynamics Monte Carlo Transition ... usually within physics and mathematics ˙ i hψ=Hψ Quantum Mechanics S = k log W Statistical Mechanics Computational Chemistry Computational chemistry is a branch of chemistry that uses principles ... reactions.(Wikipedia) Chemistry is the science that invents what it studies Theoretical Chemistry Theoretical chemistry is the study of chemistry via fundamental theoretical reasoning, usually...
  • 25
  • 368
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Is there a place for N-acetylcysteine in the treatment of septic shock" pptx

Báo cáo khoa học

... extraction, while at the same time attenuating inflammatory responses Prostacyclin, a prostaglandin synthesized in endothelial cells, is a potent vasodilator and an inhibitor of platelet and ... enhancing the intracellular content of cAMP that exerts both vasodilation and anti-inflammatory effects Pentoxifylline has been reported to inhibit platelet and leukocyte activation and lactate ... and colleagues have made a significant contribution to our understanding of the important role of antioxidant agents such as NAC in developing novel therapies for septic shock A large trial is...
  • 3
  • 469
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Bench-to-bedside review: Is there a place for epinephrine in septic shock" pptx

Báo cáo khoa học

... choice of catecholamine based on rational evaluation This is not the case for many situations in other clinical settings For example, catecholamines are used on the ward, during transportation, in ... L, Audibert G, Bauer P, Nabet P, Larcan A: Comparison of norepinephrine and dobutamine to epinephrine for hemodynamics, lactate metabolism, and gastric tonometric variables in septic shock: a ... SM, Ahrens TS, Annane D, Astiz ME, Chalfin DB, Dasta JF, Heard SO, Martin C, Napolitano LM, Susla GM, et al.: Practice parameters for hemodynamic support of sepsis in adult patients: 2004 update...
  • 5
  • 278
  • 0
Báo cáo y học:

Báo cáo y học: "Tranexamic acid in cardiac surgery: is there a cause for concern" pps

Báo cáo khoa học

... First, a potential mechanism for altering the excitatory neuronal state is recognised The lysine analogues have marked structural homology with gamma amino butyric acid (GABA) and act as competitive ... Critical Care 2010, 14:194 http://ccforum.com/content/14/5/194 cardiac chamber was opened Can this observation be causally associated with tranexamic acid administration? The statistical analysis ... tranexamic acid administration has a place in higher risk cardiac surgery and especially in surgery where a cardiac chamber is opened Competing interests In the past years DR has acted as a paid...
  • 2
  • 317
  • 0
Báo cáo y học:

Báo cáo y học: "Is Phytalgic® a goldmine for osteoarthritis patients or is there something fishy about this nutraceutical? A summary of findings and risk-of-bias assessment" pot

Báo cáo khoa học

... manuscript for publication Neither of the authors is affiliated with or funded by any manufacturer of drugs or nutraceuticals RC is statistical editor for the Cochrane Musculoskeletal Group and ... Christensen R, Bliddal H: Is Phytalgic® a goldmine for osteoarthritis patients or is there something fishy about this nutraceutical? A summary of findings and risk-of-bias assessment Arthritis ... data are confirmed, a goldmine has been struck and OA therapy is in for dramatic changes Abbreviations ES = effect size; NSAID = nonsteroidal anti-inflammatory drug; OA = osteoarthritis; RCT = randomized...
  • 3
  • 279
  • 0
Báo cáo y học:

Báo cáo y học: " Mechanical ventilation in the ICU- is there a gap between the time available and time used for nurse-led weaning?" pot

Báo cáo khoa học

... used for weaning and time available for weaning and 2) to analyse the patient and systemic factors were associated with the time available for weaning that is actually used for weaning To the best ... individual healthcare workers, a collaborative and systematic approach is needed for success Page of (page number not for citation purposes) Scandinavian Journal of Trauma, Resuscitation and Emergency ... available and time used for weaning, exists and is valid This discrepancy indicates that more studies on the organisational aspects of weaning are still needed Conclusion Our study revealed a...
  • 8
  • 338
  • 0
Trade and Poverty Is There a Connection

Trade and Poverty Is There a Connection

Tài liệu khác

... been such a sharp deterioration in transport infrastructure that it is difficult for traders to reach areas that are more than a relatively short distance from a major route It is an open question ... trade are so poor that transactions occur on a barter basis It is difficult to disentangle the relative importance of institutional and infrastructural factors in this market failure There has ... illiterate workers may be left behind or even fall One of the reasons that agricultural liberalization is such an important goal for future trade policy is that for this sector we can be reasonably...
  • 26
  • 544
  • 0
Báo cáo khoa học: A role for serglycin proteoglycan in granular retention and processing of mast cell secretory granule components ppt

Báo cáo khoa học: A role for serglycin proteoglycan in granular retention and processing of mast cell secretory granule components ppt

Báo cáo khoa học

... maximal storage seen after 26 days of culture mMCP-6 storage showed similar kinetics as for mMCP-5 In contrast, CPA protein was detected as early as after days of culture, and a maximal plateau ... placed on copper grids covered with a film of polyvinyl formal plastic (Formvar; Agar Scientific) and contrasted with uranyl acetate and lead citrate Electron micrographs were taken with a Hitachi ... radioactivity As an internal standard, 200 lL of a mixture of unlabeled heparin (4 mgÆmL)1) and CS -A (5 mgÆmL)1; Sigma, Stockholm, Sweden) was added to each sample before anion exchange chromatography analysis...
  • 12
  • 438
  • 0
LOOKING for a FIGHT IS THERE A Republican War on Science? potx

LOOKING for a FIGHT IS THERE A Republican War on Science? potx

Cao đẳng - Đại học

... on acid-free paper Parlor Press, LLC is an independent publisher of scholarly and trade titles in print and multimedia formats This book is available in paper and Adobe eBook formats from Parlor ... me and I think it has decent explanatory power over this phenomenon There is a particular kind of irrationalism Adorno identified, which is characteristic of authoritarian politics (and therefore ... performs a basic check can discover, with little effort, the full history of his efforts as tobacco lobbyist and hired gun for polluting industries What is needed, therefore is general awareness...
  • 100
  • 355
  • 0
Báo cáo Y học: Proteolytic action of duodenase is required to induce DNA synthesis in pulmonary artery fibroblasts A role for phosphoinositide 3-kinase pot

Báo cáo Y học: Proteolytic action of duodenase is required to induce DNA synthesis in pulmonary artery fibroblasts A role for phosphoinositide 3-kinase pot

Báo cáo khoa học

... instead acts as a cofactor for the cleavage and activation of PAR4 [27] Thrombin has been shown to cleave and activate PAR1, PAR3 and PAR4, whereas trypsin cleaves and activates PAR2 As duodenase ... Vector Laboratories), followed by treatment with avidin–horse radish peroxidase (Vectastain ABC kit, Vector Laboratories) and diaminobenzidine (DAB kit, Vector Laboratories) Following immunostaining, ... is specific for PAR2, was unable to induce [3H]thymidine incorporation in fibroblasts, and a similar lack of mimickery was evident for peptides specific for PAR1 and PAR4; and (b) duodenase cleaved...
  • 10
  • 437
  • 0
Loans, Interest Rates and Guarantees: Is There a Link? pdf

Loans, Interest Rates and Guarantees: Is There a Link? pdf

Ngân hàng - Tín dụng

... guarantees are guarantees granted by third parties in favor of borrowers Data are drawn from Statistical Return Loans and Bad Loans Data are drawn from Statistical Return Average Loan Life This ... Italian banks (which cover about 75 per cent of total assets of Italian banking system).5 Aggregated data on real and personal guarantees are drawn from bank supervision reports and are available ... collateralization, it is important to distinguish between inside collateral and outside collateral, and between real and personal guarantees He finds that real guarantees are not statistically related...
  • 27
  • 398
  • 0
is there a new vision for maghreb economic integration

is there a new vision for maghreb economic integration

Marketing căn bản

... Intensities Maghreb merchandise exports share similar factor intensities, particularly Morocco and Tunisia Main merchandise exports in Tunisia and Morocco (clothing, textile yarns, and floor covers) are ... global demand changes is a constant market share analysis of export performance in a country due to the relative favorable or unfavorable changes in global demand prospects It indicates how rapidly ... Maghreb countries’ revealed comparative advantage and export specialization also reveals that Tunisia’s exports of beverages have a strong comparative advantage in the Maghreb market whereas Algeria...
  • 110
  • 2,191
  • 0
báo cáo hóa học:

báo cáo hóa học:" Is there a relationship between factor V Leiden and type 2 diabetes?" doc

Hóa học - Dầu khí

... expressed as mean ± standard deviation (SD) or as number and percentage where appropriated Statistical analysis was performed with STATA http:// www.stata.com with Student t test for unpaired data or ... association between diabetes and VTE [6], but recently several Authors showed that atherosclerosis and traditional atherosclerotic risk factor as diabetes should be considered also as risk factor for ... interactions Moreover, a relevant aspect is related to the recent data present in the Literature that are linking more and more the pathophysiology of arterial and venous thrombosis: actually,...
  • 4
  • 594
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Supplement use in sport: is there a potentially dangerous incongruence between rationale and practice?" docx

Hóa học - Dầu khí

... use are specified) or beliefs about particular substances Practically, any data that allow a scientifically and statistically meaningful contingency table to be formed are suitable for such analyses ... of athletes' motivations, data from these studies are not suitable for hypothesis testing Results from quantitative analyses, assuming adequate sampling and appropriate statistical analyses are ... between rationale and supplements used by athletes can be investigated by analyzing quantitative or qualitative data Although qualitative approaches have the advantage of producing deep understanding...
  • 6
  • 444
  • 0
báo cáo hóa học:

báo cáo hóa học:" Is there an association between PEPFAR funding and improvement in national health indicators in Africa? A retrospective study" pdf

Hóa học - Dầu khí

... for an alternative approach that funds health care through a sector-wide approach[14] A sector-wide approach represents a nationally based effort to increase health sector coordination, national ... (Angola, Cameroon, Comoros, Gambia, Malawi, Mali, Sao Tome and Principe, and Togo) with medians ranging from 17.1% to 4.5%; two (Equitorial Guinea and Swaziland) have statistically significant ... Gabon, Gambia, Ghana, Guinea, Guinea-Bissau, Lesotho, Liberia, Madagascar, Malawi, Mali, Mauritania, Niger, Sao Tome and Principe, Senegal, Seychelles, Sierra Leone, Swaziland, Togo, Zimbabwe The...
  • 9
  • 342
  • 0
Báo cáo y học:

Báo cáo y học: "Disability and health-related quality of life in outpatients with generalised anxiety disorder treated in psychiatric clinics: is there still room for improvement" pdf

Báo cáo khoa học

... information for healthcare professionals and regulators who are responsible for adopting the appropriate measures at this level of care In conclusion, patients who were managed for GAD in an ... Salvador-Carulla L, Ayuso-Mateos JL, Fullana MA, Alonso J: Treatment adequacy of anxiety and depressive disorders: primary versus specialised care in Spain J Affect Disord 2006, 96:9-20 23 Saarni ... insomnia, and depression, and from moderate to intense for the pain item of SF-36 A descriptive statistical one-way analysis with values for mean, standard deviation and 95% confidence intervals...
  • 9
  • 447
  • 0
Báo cáo y học:

Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc

Báo cáo khoa học

... (GTCCTGGAGAAATATTATGTGCAG) and antisense (CGCACACAGTAGTCCCCGG) primers were used For GAPDH we used CCCTTCATTGACCTCAACTACATGG (sense) and GGTCCACCACCCTGTTGCTGTAGCC (antisense) as primers Reverse transcription PCR was ... M: Mammalian MAP kinase signalling cascades Nature 2001, 410:37-40 Palanki MS: Inhibitors of AP-1 and NF-kappa B mediated transcriptional activation: therapeutic potential in autoimmune diseases ... IκB/nuclear factor-κB (NFκB) pathway (i.e PSI; dashed line) and the NF-κB/activator protein (AP)-1 pathway SN50, it was established that the NF-κB and AP-1 pathway is relevant to Cyp7b activity All experiments...
  • 10
  • 462
  • 0
Báo cáo y học:

Báo cáo y học: "Epstein–Barr virus and rheumatoid arthritis: is there a link''''" docx

Báo cáo khoa học

... strongly associated with EBV, such as nasopharyngeal carcinoma and Burkitt’s lymphoma, anti-EBV serologies are abnormal many years before the onset of disease In nasopharyngeal carcinoma, for example, ... Linos A, Kaklamani VG, Kaklamani E, Koumantaki Y, Giziaki E, Papazoglou S, Mantzoros CS: Dietary factors in relation to rheumatoid arthritis: a role for olive oil and cooked vegetables? Am J Clin ... Kositanont U, Puthavathana P: Specific IgA antibody to Epstein-Barr viral capsid antigen: a better marker for screening nasopharyngeal carcinoma than EBV-DNA detection by polymerase chain reaction...
  • 7
  • 346
  • 0

Xem thêm