is the universe a black hole
Báo cáo y học: "To keep the catch – that is the question: a personal account of the 3rd Annual EULAR Congress, Stockholm" potx
... official EULAR journal This now has an impact factor of over and is next only to the ACR journal Arthritis and Rheumatism in its field The submission rate to the Annals is increasing substantially ... over 300 and there was a global spread of speakers, rather than a European spread I think this is exactly the right policy, although probably to some extent controversial The chairman of the scientific ... young rheumatologists” was given two sessions rather than one, and included not only young speakers who had participated in the ACR/EULAR exchange program but also some from Korea and China The significance...
- 3
- 296
- 0
Báo cáo y học: " Midlife diagnosis of Refsum Disease in siblings with Retinitis Pigmentosa – the footprint is the clue: a case report" pot
... bilateral in nature [8] The short tubular bones of the hands and feet are most often affected, in particular the terminal phalanx of the thumb and the fourth metatarsal http://www.jmedicalcasereports.com/content/2/1/80 ... Kahlert S, Schonfeld P, Reiser G: The Refsum disease marker phytanic acid, a branched chain fatty acid, affects Ca2+ homeostasis and mitochondria, and reduces cell viability in rat hippocampal ... arrhythmias, as well as neurological abnormalities indicate that Refsum patients should therefore be managed by a multidisciplinary team Treatment for RD is aimed at lowering the serum levels of phytanic...
- 4
- 356
- 0
the best way to rob a bank is t - william k. black
... times as much capital An S&L with percent capital is a few bad loans away from failure The less obvious change came from all the income and assets attributable to abusive GAAP and creative RAP An ... Reagan appointed him Bank Board chairman in 1981 FOR THE BANK BOARD, THE RACE TO THE BOTTOM WAS A SHORT ONE The Bank Board was at the bottom of the federal financial regulatory heap before Pratt’s ... others Again, stupid regulation was a major cause of the interest rate crisis, and almost everyone assumed that deregulation was the answer to the crisis Pratt ignored the fact that dubious accounting...
- 314
- 455
- 0
How Is the Ku Klux Klan Like a Group of Real-Estate Agents
... let the niggers know the war is over and that the Klan is back on the market.” Atlanta had by now become Klan headquarters The Klan was thought to hold great sway with key Georgia politicians, and ... Klux Klan and Real-Estate Agents phrase like “well maintained,” for instance, is as full of meaning to an agent as “Mr Ayak” was to a Klansman; it means that a house is old but not quite falling ... were exaggerating Male and female users typically reported that they are about an inch taller than the national average As for weight, the men were in line with the national average, but the women...
- 30
- 550
- 0
The Schwarzschild Solution and Black Holes
... on either side The singularity at r = is a timelike line, as in the other cases So THE SCHWARZSCHILD SOLUTION AND BLACK HOLES 207 for this black hole you can again avoid the singularity and continue ... world black holes aren’t truly black — they radiate energy as if they were a blackbody of temperature T = h/8πkGM, where M is ¯ the mass of the hole and k is Boltzmann’s constant The derivation ... The most famous is of course the binary pulsar, discussed in the previous section Another is the gravitational time delay, discovered by (and observed by) Shapiro This is just the fact that the...
- 53
- 334
- 0
An introduction to black holes information and the string theory
... when he discovered that a black hole will radiate away its energy in the form of Planckian black body radiation Eventually the black hole must completely evaporate Hawking then raised the question ... that it is the black hole itself which is correlated to the matter outside But eventually the black hole will evaporate Hawking then made arguments that there is no way, consistent with causality, ... is seen by the distant observer as asymptotically approaching the horizon as it is infinitely red shifted At least that is the case classically This basic description of black hole formation is...
- 199
- 437
- 0
The galactic black hole lectures on general relativity and astrophysics
... obtaining the total mass is to multiply the density ρ by the spatial volume of the star at a given time t0 However, the total mass calculated that way is larger than the total gravitating mass ... exists in the gravitational interaction of the two masses with each other Let us now distinguish the mass m as a field-generating active gravitational mass and m as a (pointlike) passive test mass ... have shown that such supermassive black holes are rather common and probably reside at the center of every galaxy Cosmologically speaking, the supermassive black hole in the Galactic Center is...
- 358
- 355
- 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... SJS170 ALS030 SJS209 SJS275 SJS276 CGGAAGATCTAACTAAGCGTGCTGCTTC TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC ... AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA CTTGATTTTGGAGGGATCTC TTAGCTACATTAAATAGGCAG GtaatacgactcactataGGGATCATGCCCATTTAG Forward (nt 1281–1298...
- 14
- 635
- 0
Tài liệu Is the long-term interest rate a policy victim, a policy variable or a policy lodestar? docx
... In the years that followed, there was a substantial rise in non-ABS issuance by the US mortgage agencies The aggregate issuance of Fannie Mae, Freddie Mac and the Federal Home Loan Banks actually ... result using annual data is that, on average over the past 30 years, a 100 basis point rise in the Federal funds rate has been associated with a 24 basis points rise in The standard deviation of ... Europe and Japan Total As shown in Graph banks At average annual rate Fannie Mae, Freddie Mac and the Federal Home Loan Source: Dealogic, BIS calculations Table Composition of marketable US Federal...
- 39
- 514
- 0
Tài liệu The Proof is in the Pudding - A Look at the Changing Nature of Mathematical Proof doc
... outlined above Along the way, we are able to acquaint the reader with the culture of mathematics: who mathematicians are, what they care about, and what they We also give indications of why mathematics ... Experimental Mathematics is published by A K Peters, a daring and innovative mathematics publisher Klaus Peters is himself a Ph.D in mathemat16 There is a grand tradition in mathematics of not leaving ... hacking away at a computer Neither of these contentions is incorrect, but they not begin to penetrate all that a mathematician really is Paraphrasing Keith Devlin, we note that a mathematician is...
- 334
- 515
- 0
Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc
... support the idea that Rac and Unkempt can translocate in the nuclear compartment and activate BAF60b ubiquitination; how these processes are co-ordinated remains to be analysed Discussion Although the ... cellular mRNA levels were monitored by RT-PCR (Access RT-PCR system; Promega, Madison, WI, USA) using Unkempt-specific primers 5¢TCTTCGAGTG CAAGTCCAAA and 5¢AAGATCACCTGTGCCTCCAC, and normalized against ... UNK-C-ter as bait allowed the isolation of several independent cDNA clones encoding the C-terminal part of BAF60b ⁄ SMARCD2 (see Materials and methods, and Fig 4A) ; BAF proteins are constitutive of the...
- 12
- 432
- 0
Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx
... indicate the a- F1-ATPase GAF/Adf-1 binding cassette has enhancer properties (A) The basal promoter activity of b-F1-ATPase is greatly increased when the a- F1-ATPase GAF/Adf-1 binding cassette is ... 5¢-CCGTCGACATTAATTTGAGAAATTATAT TGCGTCGCccgccggcCgcCacgGAGGGTGAC-3¢ (again the SalI recognition site is in bold, the location of the Adf-1 element is underlined, and nucleotides in lowercase have ... this reason, ATP synthase and in particular the a- F1-ATPase and b-F1-ATPase catalytic subunits have been often used as markers for mitochondrial biogenesis [6,31,44,45] The Drosophila a- F1-ATPase...
- 11
- 532
- 0
What is the price of a mousetrap? The assessment of value from cloud services pptx
... solution The latter has the additional attributes of being available anywhere, at anytime and on any device If it was only a simple as a mouse-trap The complication is that for most customers they already ... when assessing cloud value AMS is the paradigm where a predefined level of demand is managed internally and the remainder augmented with cloud services The apothegm is ‘Own the base and rent the ... customers have this tumour, and they should actively avoid growing it In another ebook, I explain a new business paradigm, Augmented Managed Services (AMS) This is yet another approach businesses...
- 3
- 507
- 0
Báo cáo khoa học: A pathway through interferon-c is the main pathway for induction of nitric oxide upon stimulation with bacterial lipopolysaccharide in mouse peritoneal cells pot
... GAC TCT CCC TTT GGG AAC AGT TAT GCA AAA TAG CTC TGC AGA GCC TGG AGG GGT CGA-3¢) [12] and the IRF-1 consensus sequence oligonucleotide (5¢-GGA AGC GAA AAT GAA ATT GAC T-3¢) were constructed as ... nitrite as the standard in each assay Production of IFN-c and IL-12p70 (active form) was determined as the amount in the culture supernatant obtained 24 h after stimulation The concentration of each ... by morphological criteria The murine macrophage cell line RAW264.7, originally from the American Type Culture Collection (Manassas, VA, USA) and maintained in our laboratory, was also used For...
- 10
- 395
- 0
The first three minutes a modern view of the origin of the universe s weinberg
... about the same size and shape as our own galaxy They appear elliptical because most of them are viewed at a slant, and of course they are faint because they are so far away The idea of a universe ... points A and B are the same, draw a circle through A around galaxy 1, and another circle through B around galaxy Isotropy around galaxy requires that conditions are the same at A and at the point ... generated by this apparent paradox, including perhaps the steady-state theory It may be that the removal of the age paradox by the tenfold expansion of the extragalactic distance scale in the...
- 168
- 414
- 0
The road to reality a complete guide to the laws of the universe penrose, roger
... entities may relate to physical reality I recall that when at school, at the age of about 11, I was somewhat taken aback when the teacher asked the class what a fraction (such as 3) actually is! Various ... apparent at the head of the beam, giving the whole structure the appearance of a distant giant parasol, glowing evilly, with a smoky Xaming staV The parasol’s hood began to spread and darken a daemon ... mathematical Platonism is all about To say that some mathematical assertion has a Platonic existence is merely to say that it is true in an objective sense A similar comment applies to mathematical...
- 1,123
- 542
- 4
What is the impact of microfinance on poor people? a sysTemaTic review of evidence from sub-saharan africa pptx
... microfinance programmes within Ethiopia, Ghana, Kenya, Madagascar, Malawi, Rwanda, South Africa, Tanzania (Zanzibar), Uganda and Zimbabwe, and include both rural and urban initiatives Synthesis results ... interventions, and two were of savings schemes alone They include evaluations of programmes within Ethiopia, Ghana, Kenya, Madagascar, Malawi, Rwanda, South Africa, Tanzania (Zanzibar), Uganda and Zimbabwe ... Ivory Coast, Madagascar, Malawi, Nigeria, Rwanda, South Africa, Tanzania, Uganda, Zambia and Zimbabwe One study also included data from Haiti Of these 35 studies, 33 evaluated the impact of microcredit,...
- 104
- 546
- 0
Which interest rate scenario is the worst one for a bank? Evidence from a tracking bank approach for German savings and cooperative banks potx
... Volker Wieland Corporate marginal tax rate, tax loss carryforwards and investment functions – empirical analysis using a large German panel data set Fred Ramb 26 22 2007 Volatile multinationals? Evidence ... from the labor demand of German firms Claudia M Buch Alexander Lipponer 23 2007 International investment positions and Michael Binder exchange rate dynamics: a dynamic panel analysis Christian ... certain conditions visiting researchers have access to a wide range of data in the Bundesbank They include micro data on firms and banks not available in the public Visitors should prepare a research...
- 40
- 468
- 0
Báo cáo khoa học: A novel factor XI missense mutation (Val371Ile) in the activation loop is responsible for a case of mild type II factor XI deficiency doc
... plasma as substrate (Hemoliance, Salt Lake City, UT) FXI antigen was measured by an ELISA based on a goat anti-human FXI afnity puried IgG as capture antibody and a goat antihuman FXI peroxidase-conjugated ... factor IX genes from haemophilia B families Br J Haematol 89, 409412 Maekawa H, Sugo T, Yamashita N, Kamiya K, Umeyama H, Miura N, Naka H, Nishimura T, Yoshioka A & Matsuda M (1993) Molecular ... Michaelis parameters of S-2366 hydrolysis by FXIa The Michaelis parameters, kcat and Km, were calculated on the basis of known concentration of wild-type and mutant FXIa and using the program grafit...
- 11
- 563
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25