0

is a versus has a

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học

... TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast strains used in this study Strain Genotype ... mutagenesis Primer Sequence (5¢- to 3¢) Vps4–DEL F Vps4–DEL R Vps4–TRP F Vps4–TRP R Vps4–RDF F Vps4–RDF R TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA ... other meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal helix, but not the b domain The distinguishing feature of members of the meiotic clade of AAA ATPases is the SRH motif,...
  • 23
  • 490
  • 0
 What is a Company Visual Identity?

What is a Company Visual Identity?

Tài liệu khác

... Extended palette An extended palette is available for broader (screen) applications Compared with the basic palette, this colour palette comprises a number of heavier shades Each typeface is available ... thousands are separated by a comma; main and decimal sums by a decimal point For example: EUR 1,250.00 In Dutch, thousands are separated by a dot, main and decimals sums by a comma If there are ... with a similar function already exist, or can this new form be combined with an existing form? - Does the form have a name, and is this name as short as possible? - Is all the information requested...
  • 14
  • 879
  • 0
Báo cáo y học:

Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"

Y học thưởng thức

... Minneapolis, USA) This assay measures biologically active VEGF121 and VEGF165 Statistical analysis Differences between patients and healthy controls were evaluated using a non-parametric Kruskal-Wallis test ... Critical Care Vol 12 No Kümpers et al package (SPSS Inc., Chicago, IL, USA) and the GraphPad Prism software (GraphPad Prism Software Inc San Diego, California, USA) Figure Results Decreased Ang-1 and ... coefficient and linear regression analysis was performed after logarithmic transformation of Ang-2 values (logAng-2) The primary outcome studied was 30-day survival and was calculated from the day of...
  • 9
  • 634
  • 0
Báo cáo y học:

Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"

Y học thưởng thức

... 36 and health-related quality of life after intensive care in Morocco Acta Anaesthesiol Scand 2007, 51:189-197 A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Validation of a behavioral ... presented as the mean ± standard deviation for variables with a normal distribution, and as the median and interquartile range for variables with skewed distributions Parametric or nonparametric ... participated in the design of the study, and performed the statistical analysis RA conceived of the study, participated in the design of the study, performed the statistical analysis and Available...
  • 10
  • 597
  • 0
Báo cáo y học:

Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

Y học thưởng thức

... Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N Peptidomic identification and biological validation of ... cDNA (Salton, unpublished data) was isolated via Xba I-Apa I restriction cleavage, and cloned into the NheI-ApaI sites of a pShuttle vector to generate the expression cassette under regulation ... hypothesis was rejected at the 0.05 level in all analyses Statistical analysis Results Statistical analyses were performed using SigmaStat (version 3.0, SPSS Inc., Chicago, IL) Independently measured...
  • 8
  • 499
  • 0
Life Is a Dream

Life Is a Dream

Tài liệu khác

... philosophical significance LIFE IS A DREAM DRAMATIS PERSONAE Basilio King of Poland Segismund his Son Astolfo his Nephew Estrella his Niece Clotaldo a General in Basilio's Service Rosaura a Muscovite Lady ... ROS And now a lamp, a lamp! And now the hand That carries it FIFE Oh, Lord! that dreadful chain! ROS And now the bearer of the lamp; indeed As strange as any in Arabian tale, So giant-like, and ... national type of drama which Lope had established was maintained in its essential characteristics by Calderon, and he produced abundant specimens of all its varieties Of regular plays he has left a...
  • 11
  • 367
  • 0
What is a project

What is a project

Anh văn thương mại

... integrated way in a real situation It is also usually a requirement that students should demonstrate that they can review the results and provide a critical evaluation of what was achieved and what was ... frequently Project management is a relatively recent approach to management It is a particularly effective approach to gaining management control, and enables a focus on use of resources to gain specific ... approaches have also developed in the context of large, relatively stable bureaucratic and hierarchical organizational structures If a significant amount of an organization’s work is managed through...
  • 12
  • 692
  • 0
English Collocations in Use Intermediate_What is a collocation

English Collocations in Use Intermediate_What is a collocation

Kỹ năng nói tiếng Anh

... subsides As the pain subsided, I began to relax b e racked w i t h p a i n He is emaciated and racked with pain A good dictionary will also tell you if a collocation is formal or informal For example, ... well] Harry was blissfully u n a w a r e that he was in danger [Harry had no idea at all, often used a b o u t something unpleasant] 12 English Collocations in Use Exercises 4.1 Complete each sentence ... her new grandson A d v e r b s and adjectives Adjectives often have particular adverbs which regularly collocate with t h e m They are happily married I am fully aware that there are serious...
  • 10
  • 965
  • 2
Getting Started With ASP.NET ASP.NET is a new and powerful technology for writing dynamic web pages.

Getting Started With ASP.NET ASP.NET is a new and powerful technology for writing dynamic web pages.

Kỹ thuật lập trình

... JSP is also very powerful, faster than ASP, and instantly familiar to Java programmers It allows the Java program to leverage the aspects of the Java2 platform such as JavaBeans and the Java libraries ... Windows NT and many Unix versions, and it can be built as an Apache module and as a binary that can run as a CGI When built as an Apache module, PHP is especially speedy A downside is that you have ... support via something known as the Java Virtual Machine (JVM), and there are several standard and non-standard tags that are used to add Java applets to a web page These tags tell...
  • 792
  • 596
  • 0
Tài liệu Java 3D is a client−side Java application programming interface (API) developed pdf

Tài liệu Java 3D is a client−side Java application programming interface (API) developed pdf

Kỹ thuật lập trình

... graphics APIs With careful design and implementation, performance of Java 3D applications can rival native OpenGL applications and will exceed JNI−based Java wrappers over OpenGL As a Java API, Java ... takes place that qualifies this as a 3D application In fact, in the MyJava3D example application, we cheat and use some of the Java 3D data structures This allows us to use the existing Lightwave ... in Java, which can be noticeable in performance−critical applications, is the impact of the Java garbage collector (GC) The Java runtime, the Java 3D runtime, and the application code all create...
  • 352
  • 389
  • 0
Tài liệu What Is a Web Service? ppt

Tài liệu What Is a Web Service? ppt

Kỹ thuật lập trình

... became known as the Organization for the Advancement of Structured Information Standards, or OASIS As the shortcomings of the early Web services infrastructure became apparent, members of OASIS ... in a mechanical manner, and then use it to create a proxy object that a client can use to convert method calls into SOAP requests You will this later in this chapter For now, you can concentrate ... values, and for describing the types of parameters and return values When a client calls a Web service, it must specify the method and parameters by using this XML grammar SOAP is an industry...
  • 6
  • 523
  • 0
Tài liệu Unit 1- What is a computer? pptx

Tài liệu Unit 1- What is a computer? pptx

Cao đẳng - Đại học

... as in the example below Computers accept information, perform mathematical and/or logical operations then supply new information All computers have three basic capabilities A computer is a machine ... the necessary changes so that the false statement become true A computer can store or handle any data even if it hasn’t received information to so All computers accept and process information in ... to and gives it the appropriate information; but because electric pulses can move at the speed of light, a computer can carry out vast numbers of arithmetic-logical operations almost instantaneously...
  • 4
  • 863
  • 3
Tài liệu Proxies, What is a Proxy Server? pptx

Tài liệu Proxies, What is a Proxy Server? pptx

An ninh - Bảo mật

... http_proxy /usr/etc/httpd -r /etc/inner-proxy.conf -p 8081 This is a little ugly, so there are also the following directives in the configuration file: http_proxy http://outer.proxy.server/ ftp_proxy ... http://outer.proxy.server/ ftp_proxy http://outer.proxy.server/ gopher_proxy http://outer.proxy.server/ wais_proxy http://outer.proxy.server/   ...
  • 2
  • 568
  • 1
Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx

Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx

Tài liệu khác

... Graduate Management Admission Test, which is a standardized exam given at various locations in the United States and Canada and around the world Throughout North America and in many international ... these arguments differ from that of the stem paragraph (A) is a valid argument: Given anything that is a war, if any war is to be condemned, then all wars are to be condemned (B) is not a valid argument ... a margin as any candidate in the state’s history (C) having been reelected with as wide a margin as any candidate in the state’s history (D) she was reelected with as wide a margin as any candidate...
  • 696
  • 1,001
  • 1
Tài liệu Chapter 19. Mail and Address Book Email is a fast, cheap, convenient communication medium. pptx

Tài liệu Chapter 19. Mail and Address Book Email is a fast, cheap, convenient communication medium. pptx

Hệ điều hành

... a fifth kind, but if you follow the instructions at http://members.aol.com/adamkb/aol/mailfaq/imap/applemail.html, you can read your AOL mail as if it came from a regular IMAP account.) POP accounts(Post ... (Your Mac.com account is an IMAP account, which is why you can access the mail in your Inbox repeatedly from any Mac in the world, anywhere you go You can opt for a Gmail account to be an IMAP account, ... computers that process email):POP (also known as POP3), IMAP (also known as IMAP4), Exchange, and Web-based Each has its own distinct taste, with different strengths and weaknesses (AOL mail could...
  • 5
  • 383
  • 0

Xem thêm