0

initial recognition of an asset or liability in a transaction that is not a business combination and affected neither accounting profit nor taxable income

Spatial Variation of Metal Concentrations in Watercourses of an Urban River Basin in Southeastern Brazil

Spatial Variation of Metal Concentrations in Watercourses of an Urban River Basin in Southeastern Brazil

Môi trường

... Ward method uses the analysis of variance approach to evaluate the distance between the clusters CA was applied after the data was normalized to zero mean and unit variance (standardized data) ... Hall Chapman, P.M., Wang, F (2000) Issues in ecological risk assessments of inorganic metals and metalloids, Human and Ecological Risk Assessment, 6(6) 965-988 COMIG (Companhia Mineradora Estado ... Nondetects and data analysis: statistics for censored environmental data, Wiley-Interscience Hussain, M., Ahmed, S.M., Abderrahman, W (2008) Cluster analysis and quality assessment of logged water at an...
  • 14
  • 520
  • 1
Sustainability of an energy conversion system in Canada involving large-scale integrated hydrogen production using solid fuels

Sustainability of an energy conversion system in Canada involving large-scale integrated hydrogen production using solid fuels

Môi trường

... development of Canada, and the Canadian Society for Mechanical Engineering’s Angus Medal for outstanding contributions to the management and practice of mechanical engineering He is a Fellow of the Engineering ... resources indicates the human effort involved in designing and maintaining the automated machines The ranking assigned for human resources may be higher during manufacturing, installation and maintenance ... Engineering Institute of Canada, the Canadian Academy of Engineering, the Canadian Society for Mechanical Engineering, the American Society of Mechanical Engineers and the International Energy Foundation...
  • 38
  • 611
  • 0
Life cycle assessment (LCA) of an energy recovery plant in the olive oil industries

Life cycle assessment (LCA) of an energy recovery plant in the olive oil industries

Vật lý

... land use change risks due to displacement, but that the risk is small and can be ignored for feedstock produced from wastes and on degraded land and also on set-aside and idle land, as well as ... results into an indicator for each impact category, and optional elements (normalization and weighting) that lead to a unique indicator across impact categories using numerical factors based on value-choices ... biodegradable fraction of products, waste and residues from biological origin from agriculture (including vegetal and animal substances), forestry and related industries including fisheries and aquaculture,...
  • 12
  • 647
  • 1
The Effectiveness of an Online MBA Program in Meeting Mid-Career Student Expectations pdf

The Effectiveness of an Online MBA Program in Meeting Mid-Career Student Expectations pdf

Cao đẳng - Đại học

... issues for the future Journal of the Australian and New Zealand Academy of Management, 9(3), 25-36 Chang, I-C., Hwang, H-G., Liu, C-F., Siang, S-H (2007) A study of career anchors and job characteristic ... Gender, age, and the MBA: An analysis of extrinsic and intrinsic career benefits Journal of Management Education, 29, 218-247 Smith, L J (2001) Content and delivery: A comparison and contrast of electronic ... MBA was perceived to have the greatest instrumental value for moving into the consulting field and for upward career moves in related organizations or to another field Additional analysis of...
  • 16
  • 331
  • 0
Báo cáo khoa học: Structural recognition of an optimized substrate for the ephrin family of receptor tyrosine kinases pot

Báo cáo khoa học: Structural recognition of an optimized substrate for the ephrin family of receptor tyrosine kinases pot

Báo cáo khoa học

... FE, Lamba S, Rodolfo M, Daniotti M, Scarpa A, van Tilborg AA, Leenstra S, Zanon C & Bardelli A (2007) Novel somatic and germline mutations in cancer candidate genes in glioblastoma, melanoma, and ... recognition This residue is variously an arginine in EphA3, a serine, threonine or glutamine in the EPHA isoforms or a serine–leucine or alanine–leucine insert in EPHB isoforms (Fig 4) To test whether ... New England Biolabs (Ipswich, MA, USA) in their active form and were not further modified before kinetic analysis Enzymatic activity of all wild-type EPH RTKs and EphA3 mutants (N83 0A and K785N)...
  • 10
  • 441
  • 0
Báo cáo khoa học: Identification of an osteopontin-like protein in fish associated with mineral formation pot

Báo cáo khoa học: Identification of an osteopontin-like protein in fish associated with mineral formation pot

Báo cáo khoa học

... AAAACCCAGGAGATAAACTCAAGACAACCCA AGAACCGTGGCAAAGAGCAGAACGAA AAGAGGAACACAACTCACTGCCCCAC GCTTGCCTTTGCCCAGAACTTTGTAG from SSH (a, b and c in Fig 1A) and used in a combination of RACE and standard PCR amplifications ... SaOP3-F03 SaOP2-R04 SaOPreal-FW SaOPreal-RV SaRPL2 7a- FW SaRPL2 7a- RV CGCTCCAGCCGCTGAACTCCTGAAGC CCACCCCTCAGCCCATCGACCCTACC GGCGGGACCTGACACCACCACTGACA GGTAGGGTCGATGGGCTGAGGGGTGG AAAACCCAGGAGATAAACTCAAGACAACCCA ... proteins [20] and have proposed that OP-L mammalian osteopontin 22 protein and osteopontin may have a similar cellular The most abundant and up-regulated gene obtained role (i.e as a modulator of...
  • 12
  • 445
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " On the stability of an AQCQ-functional equation in random normed spaces" potx

Hóa học - Dầu khí

... of Korea Authors’ contributions All authors conceived of the study, participated in its design and coordination, drafted the manuscript, participated in the sequence alignment, and read and approved ... quadratic and quartic, respectively, and that f (x) = 12 h(x) − 12 g(x) Lemma 1.6 Each mapping f : X ® Y satisfying (1.4) can be realized as the sum of an additive mapping, a quadratic mapping, a cubic ... Art ID 923476 Eshaghi Gordji, M, Zolfaghari, S, Rassias, JM, Savadkouhi, MB: Solution and stability of a mixed type cubic and quartic functional equation in quasi-Banach spaces Abstr Appl Anal...
  • 12
  • 395
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Integrated Detection, Tracking, and Recognition of Faces with Omnivideo Array in Intelligent Environments" pot

Báo cáo khoa học

... Analysis and Machine Intelligence , vol 25, no 12, pp 1615– 1618, 2003 S Chandrasekaran, B S Manjunath, Y F Wang, J Winkeler, and H Zhang, An eigenspace update algorithm for image analysis,” Graphical ... state x and measurement y are × 1, and I is a × identity matrix T is the sampling interval or frame duration that is updated on the fly The covariance of measurement noise ω(k) and the covariance ... [22] A Jacquin and A Eleftheriadis, “Automatic location tracking of faces and facial features in video sequences,” in Proceedings of International Conference on Automatic Face and Gesture Recognition...
  • 19
  • 341
  • 0
Báo cáo y học:

Báo cáo y học: " ytotoxic T cell recognition of an HIV-1 reverse transcriptase variant peptide incorporating the K103N drug resistance mutation" pot

Báo cáo khoa học

... obtained institutional review board approval, collected and processed samples, performed immunoassays and analyzed the results DC assisted in study design and data analysis Both authors read and ... indicate standard deviations of assays performed in triplicate If HLA A or B is important for the 103N antiviral response at RT amino acids 101–109 in subject 670 5A, then candidate alleles for ... thank Lisa Kessels and Michael Klebert for assistance with patient enrollment and sample collection, Nancy Campbell for technical assistance, and the Washington University AIDS Clinical Trials...
  • 4
  • 259
  • 0
Báo cáo y học:

Báo cáo y học: "Primary extra-cranial meningioma in the right submandibular region of an 18-year-old woman: a case report" doc

Báo cáo khoa học

... Photomicrograph showing cells arranged in short fascicles and concentric whorls and at places in a typical meningothelial pattern (hematoxylin and eosin stain; original magnification, ×100) Inset shows a ... histopathological examination of the specimen and was involved in drafting the manuscript VR treated the patient surgically and read and approved the revised manuscript SN managed the patient and ... meningioma of the external auditory canal was also reported [8] In our patient, the clinical impression was that of a salivary gland neoplasm because of its location in the submandibular area On...
  • 4
  • 355
  • 0
báo cáo khoa học:

báo cáo khoa học: " Multiple evidence for the role of an Ovate-like gene in determining fruit shape in pepper" pptx

Báo cáo khoa học

... subfamilies, the one with CaOVATE, AtOFP6, AtOFP7 and AtOFP8 and the other with AtOFP1, AtOFP2, AtOFP3 and AtOFP5, have a significant number of common amino-acids inside the domain According ... segregation into subfamilies (Figure 2) The DUF623 domain of the CaOVATE was categorized in the same subfamily as other Solanaceous plants and the DUF623 domains of AtOFP7, AtOFP8 and AtOFP6 AtOFP7 ... domain, characteristic of OFPs Bioinformatics analysis placed CaOVATE in the same protein subfamily with functionally equivalent proteins from Solanaceae plants, including tomato, and three OFP...
  • 16
  • 502
  • 0
báo cáo khoa học:

báo cáo khoa học: " Identification of an extensive gene cluster among a family of PPOs in Trifolium pratense L. (red clover) using a large insert BAC library" ppsx

Báo cáo khoa học

... TAACCCTGCTACTAATCCAAGTGCAGAAGAACAAATCAAAATCAACCTTACTTGGATGCATAAACAAATGATCTCCAACAGCAAGACCAATAGACAATTT (701) TAACCCTGCTACTAATCCAAGTGCAGAAGAACAAATCAAAATCAACCTTACTTGGATGCATAAACAAATGATCTCCAACAGCAAGACCAATAGACAATTT ... http://www.biomedcentral.com/1471-2229/9/94 100 (1) ATGATACTAACCAAAATAGCCCTAAAGAACAAGAACAAAAAGCATCACCTAGAAGAAATGTTCTAATAGGTCTAGGAGGACTTTATGGTGCTACCACTTT (1) ATGATACTAACCAAAATAGTCCTAAAGAACAAGAACAAAAATCATCACCAAGAAGAAATGTTCTAATAGGTCTAGGAGGACTTTATGGTGCTACCACTTT ... CCATTTTTACAAATCCAAATTCTTCCCTTTATGACCCTAGAAGAAATCCCTCACATCAACCACCAACAATCGTTGACCTAAACTATAACAAAGCTAATGA (601) CCATTTTTACAAATCCAAATTCTTCCCTTTATGACCCTAGAAGAAATCCCTCACATCAACCACCAACAATCGTTGACCTAAACTATAACAAAGCTAATGA...
  • 11
  • 275
  • 0
setting business strategy of an phuoc garment company in local market pdf

setting business strategy of an phuoc garment company in local market pdf

Thạc sĩ - Cao học

... quantifiable and measurably qualitative Based on corporate financial reports and analyses, financial management is a process of planning, determining and executing corporate decisions regarding ... values in short and long term Accordingly, it plays an important role in business management generally and in strategic management in particular Financial goals can be strategic Achieving financial ... assessing an organizations strengths (what an organization can do) and weaknesses (what an organization cannot do) in addition to opportunities (potential favorable conditions for an organization)...
  • 120
  • 503
  • 2
Tài liệu Báo cáo khoa học: Understanding the binding properties of an unusual metal-binding protein ) a study of bacterial frataxin pdf

Tài liệu Báo cáo khoa học: Understanding the binding properties of an unusual metal-binding protein ) a study of bacterial frataxin pdf

Báo cáo khoa học

... Acknowledgements The authors are indebted to John McCormick for production of the protein and Lelio Mazzarella for continuous encouragement and support A Pastore was funded by a FARA ⁄ MDA grant F Sica and P ... chains are not well defined in the crystal structure of the apoprotein In particular, in M4, Eu3+ is coordinated by the carboxylate oxygens ˚ ˚ ˚ of Asp23 (2.8 A and 2.6 A) and Glu19 (2.7 A) , and ... observed bleaching of the same peaks that are affected in the titration of the apoprotein We observed, in particular, the disappearance of residue 23 This suggests that Mn2+ can displace Ca2+ at very...
  • 12
  • 704
  • 0
Báo cáo khoa học: Solution structure of an M-1 conotoxin with a novel disulfide linkage pdf

Báo cáo khoa học: Solution structure of an M-1 conotoxin with a novel disulfide linkage pdf

Báo cáo khoa học

... resonance of 4,4-dimethyl-4-silapentane-1-sulfonic acid used as an internal standard Distance restraints and structure calculations An initial survey of distance constraints was performed on a series ... functions, and this is not surprising considering that they have completely different backbone scaffolds Although M-1 and M-2 branch conotoxins are similar in size and cysteine framework, and are all abundant ... mostly in mollusk- and worm-hunting cone snails Disulfide linkage analyses of two M-2 branch conotoxins, mr 3a and tx3c, have shown that they possess a distinctive disulfide bond arrangement of C1–C6,...
  • 7
  • 346
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Strong Convergence of an Implicit Iteration Algorithm for a Finite Family of " potx

Báo cáo khoa học

... smooth if and only if the duality map J is single valued and norm-to-norm uniformly continuous on bounded sets of E Recall that if C and D are nonempty subsets of a Banach space E such that C is nonempty ... be a Banach space Recall the norm of E is said to be Gateaux differentiable and E is said to be smooth if lim t→0 x ty − x t 2.1 Journal of Inequalities and Applications exists for each x, y in ... 96-2221-E-230-003 10 Journal of Inequalities and Applications References H K Xu and R G Ori, An implicit iteration process for nonexpansive mappings,” Numerical Functional Analysis and Optimization, vol 22,...
  • 10
  • 259
  • 0
Báo cáo y học:

Báo cáo y học: "Daily rhythm of circulating fat soluble vitamin concentration (A, D, E and K) in the horse" pdf

Báo cáo khoa học

... (starting at 8:00 hours on day and finishing at 4:00 on day 2) via an intravenous cannula inserted into the jugular vein Blood samples were transferred into Vacutainer tubes containing no additive ... measures analysis of variance (ANOVA) was used to determine significant differences p values < 0.05 were considered statistically significant Data were analyzed using the software STATISTICA 5.5 (StatSoft ... Journal of Circadian Rhythms 2004, 2:3 domestic animals based on organism's physiological status, we investigated the existence of circadian rhythmicity of fat soluble vitamins (A, D, E and K) in...
  • 4
  • 294
  • 0
báo cáo khoa học:

báo cáo khoa học: "Ultrasound-guided thrombin injection for the treatment of an iatrogenic hepatic artery pseudoaneurysm: a case report" ppt

Báo cáo khoa học

... manuscript All authors provided clinical expertise and participated in drafting the manuscript And all authors read and approved the final manuscript Competing interests The authors declare that ... CT and 33% by Doppler US Selective arteriography may also show active bleeding and anatomic variations such as an anomalous or replaced hepatic artery [6], and can be used in simultaneous diagnosis ... report and any accompanying images A copy of the written consent is available for review by the Editor -in- Chief of this journal Author details Department of Diagnostic and Interventional Radiology,...
  • 4
  • 309
  • 1
Báo cáo y học:

Báo cáo y học: " Skill execution and sleep deprivation: effects of acute caffeine or creatine supplementation - a randomized placebo-controlled trial" potx

Báo cáo khoa học

... using a two-way analysis of variance (ANOVA) with repeated measures on both the dominant and non-dominant passing sides A two-way repeated measures ANOVA was also used to evaluate the effects of ... sleep state, treatments and any interactions for each hormonal variable In addition, dominant versus non-dominant side skill performance during familiarisation trials and non-deprived performance ... participated in protocol design, conduct of the study, data analyses and manuscript preparation LPK, CMG, SD and BC participated in protocol design, data analyses and manuscript preparation All...
  • 8
  • 275
  • 0
Báo cáo y học:

Báo cáo y học: " New technical approach for the repair of an abdominal wall defect after a transverse rectus abdominis myocutaneous flap: a case report" pot

Báo cáo khoa học

... was involved in all investigations and assisted in the literature search, writing and editing of the manuscript All authors have reviewed and approved the final manuscript 16 Rasim ZM, Alzahrani ... providing a critical appraisal and review of the manuscript JO prepared the images, advised on the format and design and assisted in providing a critical appraisal of the manuscript VS performed the ... sheaths, a component separation of the abdominal wall (Ramirez procedure) was performed In the absence of an intact rectus abdominis muscle and anterior rectus sheath, only a vertical incision lateral...
  • 6
  • 427
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25