0

influence of the a b stoichiometry on defect structure sintering and microstructure in undoped and cu doped knn

Lead-Free Piezoelectrics pot

Lead-Free Piezoelectrics pot

Điện - Điện tử

... induced by electric field Although the < /b> polarization rotation mechanism was first based on ab initio calculations of < /b> the < /b> R phase of < /b> BaTiO3, it is reasonable to conceptually extend its application to other ... polarization rotation in the < /b> (110) plane following the < /b> R ! MA ! T path [19], similar to that predicted by ab initio calculations in the < /b> R phase of < /b> BaTiO3 The < /b> same rotation path was also confirmed ... stress and avoid misfits along the < /b> domain boundaries, particular relationships between lattice parameters of < /b> tetragonal and monoclinic MC phase must be satisfied, given in (1.1) above In this case, the...
  • 537
  • 1,876
  • 0
processing and properties of nanocomposites, 2007, p.463

processing and properties of nanocomposites, 2007, p.463

Vật lý

... Carbon Nanotube/Nanofibre Polymer Composites Carbon Nanotubes and Nanofibres Carbon nanotubes are often seen as the < /b> intersection of < /b> traditional carbon fibres with the < /b> fullerene family [6] It was ... distinction Carbon nanotubes (CNTs) have attracted particular interest because they are predicted, and indeed observed, to have remarkable mechanical and other physical properties The < /b> combination of < /b> these ... of < /b> various fibrous carbon-based materials The < /b> nanotube structure can be defined more exactly by considering a < /b> single-wall carbon nanotube (SWCNT) as a < /b> conformal mapping of < /b> the < /b> two-dimensional...
  • 463
  • 318
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Preparation and properties of copper-oil-based nanofluids" ppt

Hóa học - Dầu khí

... thermal conductivities of < /b> the < /b> base fluids and nanofluids were calculated from the < /b> established equation between l and dV/dt, and the < /b> enhanced ratios of < /b> thermal conductivity were then obtained All the < /b> ... Particle mass fraction Figure Thermal conductivity of < /b> nanofluids: (a)< /b> Variation of < /b> thermal conductivity of < /b> nanofluids at 25°C with mass fraction of < /b> nanoparticles; (b) variation of < /b> thermal conductivity ... stability of < /b> the < /b> nanofluids are also investigated Experimental Materials and preparation of < /b> ligand All the < /b> materials and solvents used in this study, P2S5, cetyl alcohol, anhydrous ammonia, benzene, cupric...
  • 7
  • 332
  • 0
Physical and magnetic properties of  co,pd  based spin valves with perpendicular anisotropy for spintronic device application

Physical and magnetic properties of co,pd based spin valves with perpendicular anisotropy for spintronic device application

Cao đẳng - Đại học

... devices, and a < /b> background on the < /b> interlayer coupling and extraordinary Hall effect mechanisms are presented Finally a < /b> summary of < /b> recent demonstrations of < /b> spin transfer switching and other spin-transfer ... between the < /b> parallel and anti-parallel configurations The < /b> orange-peel interlayer coupling can favour either parallel or anti-parallel coupling depending on the < /b> anisotropy In the < /b> case of < /b> low anisotropy, ... calculated by minimizing the < /b> total energy of < /b> the < /b> system according to instances of < /b> parallel and antiparallel magnetization alignments The < /b> angular difference between the < /b> normal to the < /b> interface and the < /b> z-direction...
  • 202
  • 318
  • 0
Investigation of new properties and applications of quadruplex DNA and development of novel oligonucleotide based topoisomerase i inhibitors

Investigation of new properties and applications of quadruplex DNA and development of novel oligonucleotide based topoisomerase i inhibitors

Cao đẳng - Đại học

... movement of < /b> A2< /b> 6 and A3< /b> 6 could, in theory, cause sever backbone bending on the < /b> non-cytosine segment (A2< /b> 6AAAT30TAAAA3 5A-< /b> ) of < /b> this circular oligonucleotide Since there was no additional physical force ... preincubation 106 5-23 Correlations between percent inhibition on topoisomerase I activity and concentration of < /b> Duplex without preincubation 106 xv Chapter Introduction 1.1 Basic Information about ... G-quadruplex is the < /b> guanine quartets (also known as guanine tetrads) composed of < /b> four guanine bases arrayed in a < /b> square planar configuration, in which each base is both the < /b> donor and acceptor of < /b> two hydrogen...
  • 158
  • 358
  • 0
Unique glass formation and mechanical properties of zr cu based alloys

Unique glass formation and mechanical properties of zr cu based alloys

Cao đẳng - Đại học

... possible)  and inhibiting  shear  band  propagation  (reducing  the< /b> shear  strain  on any  one  band  and thus  delay  fracture). The< /b> synthesis of< /b> second phase reinforced BMGs composites can be  ... the< /b> strain  rate  mismatch  in a< /b> runaway  growth  process.  The< /b> partitioning  of< /b> strain  rate  into  a< /b> shear  band  occurs  over  a< /b> finite  range  of< /b> applied macroscopic strain, and the< /b> strain in the< /b> band quickly becomes very  ... shaping  materials.  They    1. Introduction  have also been used as the< /b> material for fabricating golf club head, hand phone  casing, and penetrators [2].   In the< /b> first chapter, a< /b> general introduction to BMGs will be given. The< /b> ...
  • 153
  • 405
  • 0
Preparation and characterization of the PVDF-based composite membrane for direct methanol fuel cells

Preparation and characterization of the PVDF-based composite membrane for direct methanol fuel cells

Môi trường

... in our laboratory using a < /b> combination technique of < /b> thermally induced polymerization and phase inversion, and all of < /b> the < /b> other reagents were analytical grade 2.2 Preparation of < /b> the < /b> PVDF-based composite ... membrane and Nafion-117 membrane were measured Figure shows that the < /b> two kind of < /b> membranes report a < /b> linear relationship between CB and t, and the < /b> methanol permeability of < /b> the < /b> membranes can be calculated ... used as the < /b> non-solvent The < /b> cast solution was cast onto a < /b> clean glass plate, and a < /b> flexible composite membrane was obtained The < /b> membrane was washed several times with deionized water and then...
  • 14
  • 596
  • 1
Tài liệu Nature and Properties of Micro-organisms doc

Tài liệu Nature and Properties of Micro-organisms doc

Điện - Điện tử

... infection Suppression of < /b> cell mediated immunity Bacteria  Unicellular,  DNA and RNA  Binary  No prokaryotes fission mitochondria  Rigid cell wall containing peptidoglycan Eubacteria  Classified ... tuberculosis causes TB  M leprae causes leprosy complex cell wall (acid-alcohol fast bacilli; AFB) Treponema pallidum Unusual bacteria  Mycoplasma    E.g Mycoplasma pneumoniae (pneumonia) ... invasiveness of < /b> pathogenic bacteria by reducing opsonisation and protecting from phagocytosis  E.g Streptococcus pneumoniae in RTI  vaccination: pneumococcal; meningococcal A < /b> and C  GLYCOCALYX loose...
  • 35
  • 528
  • 0
Tài liệu Báo cáo khoa học: The localization of FGFR3 mutations causing thanatophoric dysplasia type I differentially affects phosphorylation, processing and ubiquitylation of the receptor pptx

Tài liệu Báo cáo khoa học: The localization of FGFR3 mutations causing thanatophoric dysplasia type I differentially affects phosphorylation, processing and ubiquitylation of the receptor pptx

Báo cáo khoa học

... stable transfection of < /b> cDNA constructs versus transient transfection of < /b> plasmids Polyubiquitylation is responsible for the < /b> internalization and proteasomal degradation of < /b> several plasma membrane ... occurred intracellularly or at the < /b> plasma membrane remains to be elucidated Analysis of < /b> receptor endocytosis through the < /b> use of < /b> cleavable biotin indicated that internalization of < /b> disulfide-bonded ... are mostly responsible for long-bone dysplasias including achondroplasia (ACH), the < /b> most common form of < /b> dwarfism in humans, the < /b> milder form hypochondroplasia and the < /b> neonatal lethal form thanatophoric...
  • 16
  • 573
  • 0
Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc

Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc

Báo cáo khoa học

... GCAGATCTCTTGGCGTATGATTCACTGAT GGNWSNATGGARCCNGARTTYAAYACNGG TCNGCNGCNGCRTTRTTRTCNCCYTTNGT TTGTGTAAAAGTGATGACATCGCC GTGATCCCGATTATTCTGTGTGTT GGCGATGTCATCACTTTTACACAA AACACACAGAATAATCGGGATCAC GAGAATTCAAAAGAAAGCGGGGAAGAA ... GATGGATCTATGGATGCCGCCAATG GCAAAGCTTATTTTGGATGATAACGAGGCG GCGAATTCCTACCAGACGAGAACTTAAGCC GTTTTCCCATGCACGAC GTAAAACGACGGCCAGT Cloning of < /b> sipU Cloning of < /b> sipU Cloning of < /b> sipU Cloning of < /b> sipU Cloning of < /b> sipU Cloning ... GAGAATTCAAAAGAAAGCGGGGAAGAA CGAGATCTTGTGGACATGGTCCCGTTTC CGGAATTCGCTAATGGGAGGAAATCAC TACAGATCTTTTCGTCTTGCGAATTTC CAGAATTCGTCTAGGAGGAACCACGTT GCGAGATCTTTTTGTCTGACGCATATC CAGCAATTGACCCTTAGGAGTTGGCAT GATGGATCTATGGATGCCGCCAATG...
  • 12
  • 595
  • 0
Báo cáo khoa học: Structure analysis of the flavoredoxin from Desulfovibrio vulgaris Miyazaki F reveals key residues that discriminate the functions and properties of the flavin reductase family pdf

Báo cáo khoa học: Structure analysis of the flavoredoxin from Desulfovibrio vulgaris Miyazaki F reveals key residues that discriminate the functions and properties of the flavin reductase family pdf

Báo cáo khoa học

... of < /b> DvMF avoredoxin and discuss the < /b> key residues for ligand binding and metal ion binding, based on the < /b> crystal structures Results Cloning and sequencing of < /b> the < /b> avoredoxin gene We determined the < /b> ... avoredoxin These cysteine residues are replaced by threonine and leucine in FeR and asparagine and valine in M acetivorans avoredoxin (Figs and 3D; Fig S4C) In the < /b> case of < /b> FeR, however, Cys45 is adjacent ... site instead (Fig 3D) observed increase in absorption around 340 nm is caused by the < /b> addition of < /b> NADH or NADPH Based on the < /b> amino acid comparison (Fig 1) and the < /b> crystal structure of < /b> avoredoxin,...
  • 14
  • 653
  • 0
Báo cáo khóa học: Localization, purification and properties of a tetrathionate hydrolase from Acidithiobacillus caldus pot

Báo cáo khóa học: Localization, purification and properties of a tetrathionate hydrolase from Acidithiobacillus caldus pot

Báo cáo khoa học

... Table Localization of < /b> tetrathionate hydrolase in A < /b> caldus cell fractions Distribution and activity of < /b> assayed enzymes are given as a < /b> percentage of < /b> the < /b> total protein concentration and total activity ... activity The < /b> vertical bars indicate standard deviations Due to the < /b> instability of < /b> tetrathionate in the < /b> presence of < /b> ammonium sulfate, as demonstrated by the < /b> HPLC chromatograms, ammonium sulfate was ... This assay was described by de Jong et al [21] and based on the < /b> formation of < /b> undetermined intermediates with long sulfur chains that increased absorbance at 290 nm In this study, the < /b> assay was...
  • 9
  • 609
  • 0
Báo cáo khoa học: Origin and properties of cytoplasmic and mitochondrial isoforms of taurocyamine kinase pptx

Báo cáo khoa học: Origin and properties of cytoplasmic and mitochondrial isoforms of taurocyamine kinase pptx

Báo cáo khoa học

... hypotaurocyamine (about 50% of < /b> that of < /b> the < /b> main target substrate, taurocyamine), and weak activity for lombricine and glycocyamine [19] TK is a < /b> dimeric enzyme like LK and GK [18], and the < /b> partial 16 amino ... proportional relationship between the < /b> size of < /b> the < /b> deletion in the < /b> GS region and the < /b> mass of < /b> the < /b> phosphagen substrate LK and AK each have five amino acid deletions in this region and use relatively large ... taurocyamine, lombricine, glycocyamine, creatine and arginine (Table 1) Arenicola cytoplasmic TK showed activity for the < /b> substrates taurocyamine and lombricine (9% that of < /b> taurocyamine) in agreement...
  • 10
  • 468
  • 0
Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot

Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot

Báo cáo khoa học

... preparations Protein quantitation Total protein concentration was measured at every step according to Lowry et al [18], using a < /b> suitable calibration curve obtained with BSA Molecular mass determination ... from incubation with enzyme preparations, were determined in samples by comparing their peak-integrated areas with those obtained from known concentrations of < /b> the < /b> respective standards Kinetic analysis ... Molecular structures of < /b> the < /b> hydroxybenzoic acid (I, II) and hydroxycinnamic acid (III, IV) derivatives assayed as substrates for the < /b> flavonoid 4¢-OMT The < /b> carnation cultivar ÔNovadaÕ was obtained...
  • 10
  • 624
  • 0
Báo cáo Y học: Molecular cloning, bacterial expression and properties of Rab31 and Rab32 docx

Báo cáo Y học: Molecular cloning, bacterial expression and properties of Rab31 and Rab32 docx

Báo cáo khoa học

... demonstration that platelets contain Rab31, Rab32 and Rab1 1A,< /b> adds three to the < /b> eight Rab proteins already known to be present (Rab1, Rab 3B, Rab4, Rab5, Rab6, Rab8, Rab2 7A,< /b> Rab2 7B [3±7]) Only in ... with a-< /b> granules [3] and other Rab proteins (Rab4, Rab5, Rab2 7A < /b> and Rab2 7B) have been found in fractions containing a-< /b> granules, as well as in membrane fractions [4,7] No Rab proteins have yet been ... Karniguian, A.< /b> , Zahraoui, A < /b> & Tavitian, A < /b> (1993) Identi®cation of < /b> small GTP-binding rab proteins in human platelets: thrombininduced phosphorylation of < /b> rab 3B, rab6, and rab8 proteins Proc Natl Acad...
  • 13
  • 481
  • 0
Mechanics and Properties of Composed Materials and Structures doc

Mechanics and Properties of Composed Materials and Structures doc

Kĩ thuật Viễn thông

... elastic stability of < /b> a < /b> sandwich panel (wide beam) using 2D classical elasticity They obtained global buckling and wrinkling loads of < /b> 2D sandwich panels Based on the < /b> above discussions, it can be concluded ... capacity and deformability of < /b> the < /b> masonry wall is affected by the < /b> quality of < /b> the < /b> bonds between the < /b> masonry unit and mortar, i.e the < /b> level of < /b> transfer of < /b> normal and shear stresses in the < /b> contact ... values of < /b> displacement and velocity; b and c are parameters that determine the < /b> stability and accuracy of < /b> the < /b> method [8] By substituting (6) and (7) into (5), and by introducing an incremental-iterative...
  • 195
  • 1,010
  • 0
Báo cáo Y học: Trehalose-phosphate synthase of Mycobacterium tuberculosis Cloning, expression and properties of the recombinant enzyme pdf

Báo cáo Y học: Trehalose-phosphate synthase of Mycobacterium tuberculosis Cloning, expression and properties of the recombinant enzyme pdf

Báo cáo khoa học

... contained various amounts of < /b> the < /b> recombinant TPS After an incubation of < /b> 15 min, one set of < /b> incubation mixtures was assayed by the < /b> anthrone colorimetric method and the < /b> other set was assayed by the < /b> coupled ... disrupted in Candida albicans and this mutant did not accumulate trehalose at stationary phase or after heat Fig Identification of < /b> the < /b> product produced by recombinant TPS Incubation mixtures containing ... recombinant TPS; lane 2, crude recombinant E coli to 20 lg of < /b> protein per incubation, as demonstrated in Fig 4B The < /b> increase in enzymatic activity was also linear with time of < /b> incubation for about...
  • 10
  • 428
  • 0
preparation and properties of magnetic iron oxide nanotubes

preparation and properties of magnetic iron oxide nanotubes

Vật lý

... of < /b> the < /b> vortex states and the < /b> presence of < /b> out-plane and in- plane spin configurations In our samples, the < /b> average din /dout value of < /b> nanotubes is about 0.7, and the < /b> length of < /b> many nanotubes is about ... Fig (a)< /b> XPS spectrum of < /b> ␣-Fe2 O3 nanotubes and (b) high magnification TEM image of < /b> a < /b> nanotube in sample S1 together with the < /b> creation of < /b> cation vacancies and the < /b> addition of < /b> oxygen atoms At the < /b> ... uniformly by ultrasonic irradiation The < /b> solution was then sealed in a < /b> 100-mL Te on- lined stainless steel autoclave and hydrothermally treated for 36 h at 240 ◦ C At last, a < /b> red precipitate was obtained...
  • 6
  • 552
  • 0
research on gas - sensing properties of lead sulfide-based sensor for detection

research on gas - sensing properties of lead sulfide-based sensor for detection

Vật lý

... explained One of < /b> possible reasons is that sulfur ion concentration, chemical reaction rate and temperature in uence the < /b> surface area and the < /b> activation absorption center (position and quantity) of < /b> ... NO2 gas concentration exceeded a < /b> certain value, as it can be seen in Fig The < /b> relation curves between the < /b> response and gases concentration show a < /b> saturation point and an in exion The < /b> response saturation ... surface of < /b> PbS absorption ways and means of < /b> electron transfer are different The < /b> variations in response of < /b> the < /b> sensor based on PbS prepared with Na2 S at 80 ◦ C with the < /b> concentration of < /b> NH3 at the...
  • 6
  • 518
  • 0

Xem thêm