inferences about the mode of gene action at the qtl

Báo cáo sinh học: " Identiﬁcation of a differentially expressed gene, ACL, between Meishan · Large White and Large White · " pps

Ngày tải lên : 14/08/2014, 13:21

... GGTCTTGGCATAGTCATAGGT GCTACGCGTTCAGCACTATCAGATCGGG GCTACGCGTCCTTCCTAGCCCCACCT GCCACGCGTATCTATTAGCCTCGTCCCAC GATACGCGTCAGCCCGCCACATCTCAG GATACGCGCATAGCCCAGCCCATCTC GATACGGCGAATTGGGAGGAAGCC GATACGCAATCGCCGGGCGGCTCGC ... hybrids and their parents (Fig 3) 3.5 Features of the 50 -ﬂanking region of porcine ACL gene To identify the location of the promoter region in the porcine ACL gene, we have studied the transcriptional ... hybrids and their parents ACL is a cytosolic enzyme that catalyses the formation of acetyl-coenzyme A (CoA) and oxaloacetate from citrate and CoA, with the hydrolysis of ATP to ADP and phosphate [7]...

13
272
0

Báo cáo khoa học: 17b-Hydroxysteroid dehydrogenase type 11 is a major peroxisome proliferator-activated receptor a-regulated gene in mouse intestine pdf

Ngày tải lên : 16/03/2014, 18:20

... activation of the 17b-HSD-11 gene in the intestine became clear, whether another region of the gene is necessary or an unknown mechanism is operating for the activation could not be clariﬁed by the ... hepatoma Fao cells Wy14 643 was added to the medium of rat hepatoma Fao cells in the conﬂuent stage at time and the cells were collected at the time indicated for total RNA isolation and Northern ... than that of typical PPARa-target genes Promoter structure of the 17b-HSD-11 gene and transcriptional regulation All the above data strongly suggest that expression of the 17b-HSD-11 gene is...

6
272
0

báo cáo khoa học: " Multiple evidence for the role of an Ovate-like gene in determining fruit shape in pepper" pptx

Ngày tải lên : 11/08/2014, 11:21

... development and cell pattern in the Arabidopsis embryo sac [15] The two subfamilies, the one with CaOVATE, AtOFP6, AtOFP7 and AtOFP8 and the other with AtOFP1, AtOFP2, AtOFP3 and AtOFP5, have a significant ... (At) OFP6 [Uniprot: Q0WSS3], AtOFP7 [Q9ZU65], AtOFP8 [Q3E9B4] AtOFP1 [Q9LZW2], AtOFP2 [O04351], AtOFP3 [Q9LVL4] and AtOFP5 [Q8VZN1] are categorized in another subfamily (subf 6) along with the ... increase in the expression of the gene in the DAA fruit of the infiltrated plant compared to the expression in the DAA fruit of the WT The analysis of the CaOvate genomic sequences obtained from the...

16
502
0

báo cáo khoa học: " AtMRP6/AtABCC6, an ATP-Binding Cassette transporter gene expressed during early steps of seedling development and up-regulated by cadmium in Arabidopsis thaliana" doc

Ngày tải lên : 12/08/2014, 05:20

... AAATATGCGGCCGCTATAAAGTGAACATTTTGGTCAACACTCAGTTCCTGATGGA GACCAAGGTTGTGAATCTGATTATACACTTCTATTTACGCTTTT ATAACTAGAAGAAATATGCGGCCGCTATAAA GCCCATGGTGCTGCATGGACTGACATGC GCTCCTCGCCCTTGCTCACCATGCTTCTTTTGGATTTGGATTC ... up-regulated by Cd in plant roots, whereas the expression level of AtMRP1 remained unchanged The likely gene duplication at the basis of the AtMRP3/AtMRP6/AtMRP7 cluster [38] led us to investigate the ... than AtMRP3 and AtMRP7 or that the basal levels of expression of AtMRP3/7 are sufficient to compensate for the absence of AtMRP6 Alternatively, these two genes could be up-regulated in the few...

11
251
0

Functional role of p16INK4A and n myc downstream regulated gene 1 (NDRG1) up regulation in cervical carcinoma

Ngày tải lên : 14/09/2015, 11:19

... by the actions of the HPV high-risk E7 oncoproteins, which act downstream of p16/cdk4/cyclin D It is thought that the direct inactivation of Rb by E7 causes the up-regulation of p16 via a negative ... expressed genes in cervical cancer 35 Section – Introduction and Literature Review 1.1 The cervix The cervix is the lower portion of the uterus (or womb) which connects the body of the uterus to the ... Figure 1-1 Anatomy of the uterine cervix The cervix is the lower part of the uterus or womb The endocervix, or cervical canal is made up of mucous-secreting glandular epithelial cells and the ectocervix,...

152
275
0

Báo cáo Y học: Group IID heparin-binding secretory phospholipase A2 is expressed in human colon carcinoma cells and human mast cells and up-regulated in mouse inﬂammatory tissues doc

Ngày tải lên : 18/03/2014, 01:20

... reports [7–12], the membrane-bound fraction contained more than 50% of the native enzyme (Fig 1C) The distribution of the KE2 mutant between the two fractions was similar to that of the native enzyme ... Searching the nucleic acid database reveals the presence of the TATA box and the binding motifs for AP-1 and NFjB in the putative 5¢-ﬂanking promoter region of the human sPLA2-IID gene, consistent ... degradation, thereby leading to inactivation of the HSPG-binding sPLA2s [34,35] Thus, in addition to their enzymatic characteristics, the HSPG-binding properties of sPLA2s also dictate their...

10
334
0

Báo cáo khoa học: Microarray analyses of hypoxia-regulated genes in an aryl hydrocarbon receptor nuclear translocator (Arnt)-dependent manner ppt

Ngày tải lên : 23/03/2014, 06:20

... 5) The demonstration of the induction of SUI1-RS1 and the repression of PSMA3 in response to hypoxia in the absence of both Arnt and HIF-1a indicates that hypoxia regulates the expression of ... predictions generated by microarray analysis We next investigated whether the expression of these 13 genes was also regulated by HIF-1a (Table 5) It was determined that seven of the 13 genes (IER3, ... instead reduced the fold induction of these genes by approximately one-half, thereby suggesting that HIF-1a plays a role in regulating hypoxiamediated induction of these genes, at least in part...

17
264
0

Báo cáo khoa học: "Radiosensitization and growth inhibition of cancer cells mediated by an scFv antibody gene against DNA-PKcs in vitro and in vivo" docx

Ngày tải lên : 09/08/2014, 09:20

... were irradiated as described in materials and methods Result shows that anti-DPK3-scFv largely attenuated the growth rate of the tumours generated from HeLa-DPK3-scFv cells after the radiotherapy ... different group at the beginning of the radiotherapy, and there occurred animal death from the sixth day after the beginning of radiotherapy $ p = 0.02, 0.044, 0.035 as compared with the group pcDNA, ... these data indicate that anti-DPK3-scFv owns the features of a biological radiosensitizer by targeting DNAPKcs It is likely that the extent of radiosensitization by antiDPK3-scFv is relative modest...

11
370
0

Báo cáo y học: "Candida albicans induces cyclo-oxygenase 2 expression and prostaglandin E2 production in synovial fibroblasts through an extracellular-regulated kinase 1/2 dependent pathway" pps

Ngày tải lên : 09/08/2014, 14:20

... protein loading control The graph shows the results of densitometric analysis of bands expressed as the mean ± SD of the relative change in COX-2/tubulin ratio with the ratio of the control condition ... were expressed as ratio of the band intensity of the target gene to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and the ratio of the band intensity of COX-2/ GAPDH in the control condition ... deviation (SD) of the relative fold change in COX-2/GAPDH ratio with the ratio of the control condition normalized to (N = 6, * P < 0.05) (b) Protein expression A representative western blot of...

9
403
0

Báo cáo y học: "Advanced radiological work-up as an adjunct to decision in early reconstructive surgery in brachial plexus injuries" pptx

Ngày tải lên : 10/08/2014, 10:20

... 34 The agreement between the radiological findings of every individual spinal nerve root and the preoperative findings of each root at the time of the surgical exploration was estimated All patients ... in some of the evaluated images However, the evaluation of the images in our study was focused on the individual roots rather than on individual patients We believe that our findings of high ... the work-up of brachial plexus injury is the diffusion weighted MR neurography [10] However, the main limitation of this technique is lack of depiction of cervical nerves above the level of the...

7
358
0

báo cáo khoa học: " A novel mutation in the calcium-sensing receptor gene in an Irish pedigree showing familial hypocalciuric " doc

Ngày tải lên : 11/08/2014, 02:22

... that he had seven brothers and no sister Three of them had died: one at the age of six months of unknown cause; one at the age 26 years of an epileptic seizure; and one at the age of 36 years of ... C > A transversion at point 213 of the CaSR gene of the proband Figure Heterozygosity for a C > A transversion at point 213 of the CaSR gene in one of the affected sons of the proband Elamin ... individual mutations Conclusion The investigation of this Irish family with hypercalcemia led to the diagnosis of FHH and to the identification of a novel mutation in the CaSR gene We believe that the...

5
385
0

báo cáo khoa học: " Involvement of S-adenosylmethionine-dependent halide/thiol methyltransferase (HTMT) in methyl halide emissions from agricultural plants: isolation and characterization of an HTMT-coding gene from Raphanus sativus (daikon radish)" ppt

Ngày tải lên : 12/08/2014, 03:21

... concentration of the gas phase, assuming that the equilibrium of each compound in air and water in a vial was attained One unit (U) of enzyme activity was defined as the amount of the enzyme that catalyzed ... methyltransferases of B oleracea corresponds to the concentration of glucosinolate This suggests that RsHTMT in R sativus may be involved in the detoxification of sulfur compounds produced by the degradation of ... dithiothreitol (DTT) at a ratio of 0.1 g sample/0.5 ml buffer The crude extract was centrifuged at 4°C for 30 at 10,000 × g to obtain the supernatant In the case of R sativus, the supernatant was filtered...

10
232
0

Báo cáo khoa học: " Bioinformatic evidence for a stem-loop structure 5''''-adjacent to the IGR-IRES and for an overlapping gene in the bee paralysis dicistroviruses" pptx

Ngày tải lên : 12/08/2014, 04:20

... (B8) the null model, in each window, is that the sequence is non-coding, while the alternative model is that the sequence is coding in the +0/CDS2 frame Positive scores favour the alternative model ... The MLOGD statistics, on the other hand, indicate that the positive coding signature in the +1 frame extends right up to the 5' end of CDS2 (Figure 2B, panel 11), thus favouring the model in which ... portion of ribosomes initiate at or near the usual IGR-IRES initiation site but in the +1 reading frame If ORFX initiation occurs at the normal IGR-IRES initiation site but in the +1 frame then...

8
258
0

Báo cáo y học: "B cell depletion in diffuse progressive systemic sclerosis: safety, skin score modification and IL-6 modulation in an up to thirty-six months follow-up open-label trial" docx

Ngày tải lên : 12/08/2014, 12:20

... represents the modification of different parameters in each patient during the follow up Each symbol (on the left) represents one patient and corresponds to the number of the patient of Table number of ... improvement of the skin score in the first six months of follow up and an earlier repopulation of B cells, similar to the data reported by the Lafyatis and colleagues, in which the majority of patients ... related to the rituximab treatment This may suggest that IL-6 might contribute to the active phase of the disease The decrease in IL-6 at the systemic levels could be the biological premise of the...

10
291
0

Báo cáo y học: " Expression of Toll-like receptor 2 is up-regulated in monocytes from patients with chronic obstructive pulmonary disease" pdf

Ngày tải lên : 12/08/2014, 16:20

... that the upregulation of TLR-2 could not be the only explanation behind the increased levels of inflammatory mediators Thus different levels of molecules of the TLR intracellular signalling pathway ... trigger of AECOPD [6], we hypothesized that TLR may participate in the regulation of inflammation in COPD, particularly during the episodes of AECOPD To investigate it, we first compared the expression ... inflammation, flare-up during the episodes of acute exacerbation (AECOPD) that occur often in these patients [1] It is generally accepted that some form of bacterial and/or viral infection is the...

9
486
0

Đồ án Thiết kế đường sắt F1

Ngày tải lên : 08/10/2012, 08:45

... 10 10 2 = 4,06 (KG/T) + 0: lực cản đoàn toa xe tính theo công thức: = 0(1) + 0(2) - (6.1.2) 1; : tỷ lệ toa xe theo trọng lợng,tính theo công thức: = 1.q1 ; = 1-1 2.q2 + 2.q2 1,2 tỷ lệ ... Rmin với theo điều kiện kinh tế ,kỹ thuật nhng giai đoạn hạn chế thời gian nên giảm bớt bớc so sánh chọn Rmin Từ điều kiện ta lấy theo tốc độ Rmin qua lớn không thực đợc vạch tuyến , theo qui ... : - Phân bố theo tiêu chuẩn thống - Phân bố theo yêu cầu riêng tuyến Trần văn quyền lớp : cầu đường sắt _ k47 _tc Page 34 THIếT Kế ĐƯờng sắt f1 bm : đường sắt 2011 a./ Phân bố theo tiêu chuẩn...

26
5K
33

Báo cáo y học: "Users' guides to the medical literature: how to use an article about mortality in a humanitarian emergency"

Ngày tải lên : 25/10/2012, 10:31

... use the 95% CI, the range that includes the true mortality rate 95% of the time The narrower the CI, the closer the lower and upper boundaries of the CI are to the point estimate, the greater ... findings? What are the results? • How large is the mortality rate? • How precise is the estimate of the mortality rates? • What is the absolute death toll over the period of analysis? Will the results ... population Rates are usually expressed as a Crude Mortality Rate [CMR], most often as the number of deaths per 10,000 individuals in the population per day The CMR provides the number of deaths...

9
694
0

Báo cáo y học: "Elevated plasma homocysteine is positively associated with age independent of C677T mutation of the methylenetetrahydrofolate reductase gene in selected Egyptian subjects"

Ngày tải lên : 03/11/2012, 09:49

... regarding the folate level in the studied groups might be explained by the high level of fruits and green vegetables in the diet of the Egyptian population in general However, the lack of correlation ... 1999;19:217-46 Selhub J, Miller JW The pathogenesis of homocysteinemia: interruption of the coordinate regulation by Sadenosylmethionine of the remethylation and transsulfuration of homocysteine Am J Clin ... band at the 198 base pair (Bp) The heterozygote CT showed two bands, one at the 198 and the other at the 175 base pair respectively (the third band of 23 base pairs could not be visualized on the...

12
519
0

Đồ án cấu trúc máy in

Ngày tải lên : 14/08/2013, 08:53

... HSB •Màu sắc (HUE_H):là nói đến màu sắc dạng hay hai màu chủ đạo, tính theo vị trí vòng chuẩn mô tả theo độ •Độ bão hoà(Staturation_S):cho biết cường đọ màu chủ đạo, đo tỉ lệ phần trăm •Độ sáng ... ,một chuẩn Microsoft tạo cấu trúc chung cho máy in GDI □Các loại máy in khác : 1.Máy in đặc 2.Máy in nhuộm bốc 3.Máy in kính ảnh màu nhiệt (thermo autochrome) 4.Máy in sáp nhiệt(thermo Wax) 5.Máy ... với thiết bị ngoại vi liệu truyền USB theo chế độ: •Chế độ cao tốc 12Mbs •Chế độ chậm 1.5Mbs 3.Cáp USB : -Cáp USB gồm dây ,2 dây (D+,D-), để truyền tải liệu theo phương pháp vi sai,2 dây lại dây...

51
1.1K
9