independent growth factor receptor tyrosine kinase regulation of hif 1 a key role for the egfr family
Tài liệu Báo cáo khoa học: Mitogen-activated protein kinase phosphatase-1 modulated JNK activation is critical for apoptosis induced by inhibitor of epidermal growth factor receptor-tyrosine kinase pdf
... survival and growth signaling pathways such as the Ras-MAPK pathway and PtdIns3K ⁄ Akt pathway, as a consequence of inactivation of EGFR [10 13 ] The PtdIns3K ⁄ Akt pathway is downregulated in ... nM AG1478 Scale bar, 10 0 lm (D) PC-9 and J1 2A5 cells were treated with 500 nM AG1478 Lysates were prepared at the indicated time points after the AG1478 addition and analyzed for caspase activity ... dominant-negative form of JNK, and isolated two clones, J1 2A5 and J12B6 The results 12 58 of a JNK kinase assay confirmed that J1 2A5 cells had no detectable activity (Fig 3A) A colorimetric assay for cell viability,...
- 11
- 659
- 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt
... using a LKB Wallac 12 11 betacounter Automatic quench correction was made by the external standard channels ratio method The data was analyzed by Student’s unpaired t-test Measurement of TNF -a MonoMac-6 ... diluted in the same buffer where appropriate Standards ranging from 15 .6 to 10 00 pgÆmL )1 and samples (10 0 lL) were added to the plate and incubated for h The plate was washed as above and 10 0 lL ... F.H (19 91) Characterization of CoA -independent transacylase activity in U937 cells Biochim Biophys Acta 10 81, 339–346 Bradford, M.M (19 76) A rapid and sensitive method for the quantitation of microgram...
- 7
- 322
- 0
báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx
... Rouached et al BMC Plant Biology 2 011 , 11 :19 http://www.biomedcentral.com /14 71- 2229 /11 /19 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Gojon A, Nacry P, Davidian JC: Root uptake regulation: a ... 2 010 , 10 :78 Tomatsu H, Takano J, Takahashi H, Watanabe-Takahashi A, Shibagaki N, Fujiwara T: An Arabidopsis thaliana high-affinity molybdate transporter required for efficient uptake of molybdate ... mutagenesis of Arabidopsis thaliana Science 2003, 3 01: 653-657 doi :10 .11 86 /14 71- 2229 -11 -19 Cite this article as: Rouached et al.: The transcription factor PHR1 plays a key role in the regulation...
- 10
- 427
- 0
Báo cáo y học: "Science review: Redox and oxygen-sensitive transcription factors in the regulation of oxidant-mediated lung injury: κ role for nuclear factor-κ" pdf
... (NIH; Bethesda, USA) (Philip E Bickler, Department of Anesthesia and Perioperative Care, University of California, San Francisco, California, USA) The work of the author was performed at the University ... modulation of this transcription factor may bear a typical therapeutic approach for the control and regulation of inflammatory-associated diseases Available online http://ccforum.com/content/6/6/4 81 Figure ... 46:705- 716 Available online http://ccforum.com/content/6/6/4 81 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 κ Baldwin AS: The transcription factor NF-κB and human disease J Clin Invest 20 01, ...
- 10
- 373
- 0
Báo cáo y học: "Science review: Redox and oxygen-sensitive transcription factors in the regulation of oxidant-mediated lung injury: α role for hypoxia-inducible factor-1α" pptx
... 20 01, 2 81: 311 - 316 25 Haddad JJ, Safieh-Garabedian B, Saadé NE, Land SC: Thiol regulation of pro-inflammatory cytokines reveals a novel immunopharmacological potential of glutathione in the alveolar ... VHL HIF- 1a ROS Ub Proteasome Mn Ni Co VHL HIF- 1a NADP 6PG G6P Hypoxia VHLHIF-1b HIF- 1a Degradation Nucleus Potential oxygen-sensing mechanisms and the role of the transcription factor hypoxia-inducible ... Hypoxia; Inflammatory Signals Antioxidants ROS Mitochondrion ∆ Phosphorylation and Kinase Regulation ↑ HIF- 1 Protein Stabilization ↑ HIF- 1 Nuclear Translocation ↑ HIF- 1 Transcriptional Activity...
- 8
- 319
- 0
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx
... most available in the form of organic compounds, such as albuminous material Carbon in the form of carbohydrates, as sugar or starch, is most readily attacked by bacteria Inasmuch as the bacteria ... frequently the cans are not cleaned immediately upon arrival at the farm, so that the conditions are favorable for rapid fermentation Many of the taints that bother factories are directly traceable ... from another As far as these characters can be used, they are taken, but in addition, many characteristics of a physiological nature are added The way that the organism grows in different kinds of...
- 201
- 540
- 0
SOME ECONOMIC CONSEQUENCES OF GLOBAL AGING: A Discussion Note for the World Bank doc
... Belarus 85 41 26.5 Armenia 416 2 24.0 Serbia 8644 22.6 Azerbaijan 4575 19 .5 Kazakhstan 8699 17 .1 Dominican Republic 5 214 15 .2 Costa Rica 8 712 19 .9 El Salvador 5439 16 .1 Uruguay 9266 21. 4 Albania ... 2050 Myanmar 838 18 .9 Peru 6452 16 .5 Vietnam 214 3 19 .2 Ecuador 6737 17 .5 Moldova 219 0 22.0 Thailand 70 61 23.3 Mongolia 2609 17 .4 Jamaica 718 9 16 .9 Indonesia 3209 18 .6 Suriname 7279 21. 6 Guyana 3278 ... share equals the rate of change of P L , which is the rate of population a care expenditures on the elderly is: aging, and the rate of change of Ca y , which is the rate of health cost increase...
- 38
- 311
- 0
Báo cáo khoa học: "SemiPro-inflammatory cytokines play a key role in the development of radiotherapy-induced gastrointestinal mucositis" pptx
... 5’-GTGCATCATCGCTGTTCATACA TNF Forward: 5’-GTGATCGGTCCCAACAAG-3’ Results 71 X66539 Reverse: 5’-AGGGTCTGGGCCATGGAA-3’ b actin Forward: 5’-AGGCCAACCGTGAAAAGATG-3’ 10 1 NM_0 311 44 Reverse: 5’-ACCAGAGGCATACAGGGACAA-3’ ... IL-1b Forward: 5’-CACCTCTCAAGCAGAGCACAGA-3’ Size Accession (bp) No 81 NM_0 315 12 Forward: 5’-ATATGTTCTCAGGGAGATCTTGGAA-3’ 80 NM_0 315 12 Reverse: 5’-ACGGGTTCCATGGTGAAGTC-3’ IL-6 Reverse: 5’-GTGCATCATCGCTGTTCATACA ... in the colon was weak-moderate over six weeks of radiotherapy Staining was variable between the basal and apical regions of the crypts and did not significantly change of the course of radiotherapy...
- 8
- 335
- 0
Báo cáo y học: "Molecular control of HIV-1 postintegration latency: implications for the development of new therapeutic strategies" ppsx
... acetylation and recruitment of CBP, NF-kappaB, and c- http://www.retrovirology.com/content/6 /1/ 111 11 3 11 4 11 5 11 6 11 7 11 8 11 9 12 0 12 1 12 2 12 3 12 4 12 5 12 6 12 7 12 8 12 9 13 0 13 1 13 2 13 3 Jun to the ... http://www.retrovirology.com/content/6 /1/ 111 15 3 15 4 15 5 15 6 15 7 15 8 15 9 16 0 16 1 16 2 16 3 16 4 16 5 16 6 16 7 16 8 16 9 17 0 HIV -1 replication and proviral DNA (COSMIC trial) Aids 2002, 16 :14 79 -14 87 Lafeuillade A, Poggi C, Chadapaud S, ... not for citation purposes) Retrovirology 2009, 6 :11 1 13 4 13 5 13 6 13 7 13 8 13 9 14 0 14 1 14 2 14 3 14 4 14 5 14 6 14 7 14 8 14 9 15 0 15 1 15 2 nodeficiency virus reactivation Biochem Pharmacol 2008, 75 :13 70 -13 80...
- 29
- 322
- 0
Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc
... GTAACCAGTACGAAAAAAGATA CATTT 11 65 MSC1F TCTTCGGATCACCCAGTTTC 12 78 NPT1 5' 11 66 MSC1R G AAGCCTTAGCGTCGTCAAC CATTGTGATTTTATTCAATGTTT CTTT 10 84 CTT1F AAAGAGTTCCGGAGCGTGTA 12 79 NPT1 3' CAGGGTGTGGAAGAACAGGT 10 85 ... measurements Table Primers for Q RT-PCR Primer Alias Sequence 10 82 ACT1F GCCTTCTACGTTTCCATCCA 10 83 ACT1R GGCCAAATCGATTCTCAAAA 13 67 PAC2F AATAACGAATTGAGCTATGACACCAA 13 68 PAC2R AGCTTACTCATATCGATTTCATACGACTT ... Issue 10 , Article R146 10 0 10 cdc13 -1 cdc13 -1 CDC13+ CDC13+ 0 .1 cdc13 -1 10 cdc13 -1 CDC13+ CDC13+ cdc13 -1 CDC13+ cdc13 -1 CDC13+ 0 .1 10 0 .1 cdc13 -1 cdc13 -1 10 CDC13+ CDC13+ cdc13 -1 cdc13 -1 YKL161c...
- 17
- 432
- 0
Báo cáo khoa học: Calmodulin-mediated regulation of the epidermal growth factor receptor doc
... 10 6 10 7 10 8 10 9 11 0 11 1 11 2 11 3 11 4 11 5 FEBS Journal 277 (2 010 ) 327–342 ª 2009 The Authors Journal compilation ª 2009 FEBS activity in human breast cancer cell lines Breast Cancer Res Treat 11 5, ... P Sanchez-Gonzalez et al Calmodulin and the EGFR tion of the Ca2+-dependent tyrosine kinase PYK2 to the EGFR [11 5] Carbachol also induces the association of Src to the EGFR [11 5] The implication ... their pathogenesis [16 19 ] The Ca2+ signal generated by the EGFR The activation of the EGFR generates a Ca2+ signal, broadly defined as the transient rise of the intracellular concentration of Ca2+...
- 16
- 459
- 0
Báo cáo khoa học: Epidermal growth factor receptor-regulated miR-125a-5p – a metastatic inhibitor of lung cancer potx
... epidermal growth factor receptor tyrosine kinase inhibitor targeted to the treatment of cancer Bioorg Med Chem Lett 11 , 19 11 19 14 Ono M, Hirata A, Kometani T, Miyagawa M, Ueda S, Kinoshita H, Fujii ... S, Hart S & Ullrich A (20 01) The epidermal growth factor receptor family as a central element for cellular signal transduction and diversification Endocr Relat Cancer 8, 11 – 31 Brabender J, Danenberg ... compilation ª 2009 FEBS 5577 MiR -12 5a- 5p inhibiting metastasis 10 11 12 13 14 15 16 G Wang et al (2002) Frequent deletions and down -regulation of micro-RNA genes miR15 and miR16 at 13 q14 in chronic...
- 8
- 536
- 0
Báo cáo khoa học: Phosphorylation of Hrs downstream of the epidermal growth factor receptor docx
... receptor kinase When considering tyrosine kinases that are activated downstream of the EGF receptor, we regarded Src family kinases as possible candidates, as these kinases are activated downstream of ... the receptor at the acidic endosomal pH, thus activating the receptor kinase, transforming growth factor a (TGFa) rapidly dissociates and leaves the EGF receptor inactive after internalization ... S .A (19 90) Association between the PDGF receptor and members of the src family of tyrosine kinases Cell 62, 4 81 492 Dahl, M.E., Arai, K.I & Watanabe, S (2000) Association of Lyn tyrosine kinase...
- 7
- 343
- 0
Báo cáo khoa học: Mutation of epidermal growth factor receptor is associated with MIG6 expression docx
... EGFR- mitogen-activated protein kinase (MAPK) cascade are particular major targets [7 10 ] Therefore, quantitative transcriptional outcomes, in addition to qualitative ones, may be altered if EGFR kinase activity ... Sordella R, Gurubhagavatula S, Okimoto RA, Brannigan BW, Harris PL, Haserlat SM, Supko JG, Haluska FG et al (2004) Activating 5250 15 16 17 18 19 20 21 22 23 mutations in the epidermal growth factor ... such as L858R and delL747-P753insS in the kinase domain, which also enhance EGF-dependent EGFR activation [11 ,12 ] Huang et al [13 ] performed mutational analysis of the EGFR gene from exons 18 –21...
- 13
- 347
- 0
Báo cáo khoa học: " Assessment of Epidermal Growth Factor Receptor (EGFR) expression in human meningioma" docx
... JI participated in the acquisition of the data and in drafting the manuscript TH participated in the design of the study and performed the statistical analysis EHH and AP participated in case ... University, 11 1 South 11 th Street, Philadelphia, PA 19 107, USA and 8Department of Pathology, Jefferson Medical College of Thomas Jefferson University, 11 1 South 11 th Street, Philadelphia, PA 19 107, USA ... et al Radiation Oncology 2 010 , 5:46 http://www.ro-journal.com/content/5 /1/ 46 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Jaaskelainen J, Haltia M, Servo A: Atypical and anaplastic...
- 7
- 302
- 0
Rapid detection of epidermal growth factor receptor mutations with multiplex PCR and primer extension in lung cancer pdf
... G >A G 719 C, G 719 S 5'-TGAATTCAAAAAGATCAAAGTGCTG-3' 25 mer 215 6 G>C G 719 A 5'-AAACTGAATTCAAAAAGATCAAAGTGCTGG-3' 30 mer 2235-2249 del E746 -A7 50 del 5'-GAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAA-3' 35 mer ... E746 -A7 50 del 5'-TCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAG-3' 41 mer 2237-2254 del E746-T7 51 del 5'-(T)20AGTTAAAATTCCCGTCGCTATCAAGG-3' 46 mer 2240-2257 del L747-S752 del 5'-(T)23AGTTAAAATTCCCGTCGCTATCAAGGAAT-3 ... 5'-CTGGCACTGCTTTCCAGCAT-3' E18-3' 5'-GCTTGCAAGGACTCTGGGCT-3' E19-5' 5'-GCATCGCTGGTAACATCCAC-3' E19-3' 5'-AGATGAGCAGGGTCTAGAGC-3' E20-5' 5'-ATCGCATTCATGCGTCTTCA-3' E20-3' 5'-AGACCGCATGTGAGGATCCT-3'...
- 6
- 234
- 0
báo cáo khoa học: "Sustained complete remission of human epidermal growth factor receptor 2-positive metastatic breast cancer in the liver during long-term trastuzumab (Herceptin) maintenance therapy in a woman: a case report" docx
... patient achieves long-lasting remission on maintenance trastuzumab therapy We also speculate that the specific localization of breast cancer metastases may be a factor given that many of the cases ... epidermal growth factor receptor 2; MBC: metastatic breast cancer Authors’ contributions JS collected and analyzed the data of the study and wrote the manuscript AD collected the data of the patient, ... these cases ranges from four months to eight years, and in all cases, maintenance therapy was based on trastuzumab One of these cases also illustrates the risk of withdrawing trastuzumab treatment...
- 4
- 211
- 0
Báo cáo y học: "Role of epidermal growth factor receptor activation in regulating mucin synthesis" pdf
... [10 ], COPD [11 ], and acute severe asthma [17 ] Asthma and nasal polyps The secretory state of the airways may vary considerably among asthmatic persons Amishima et al [18 ] reported increased EGFR ... Munakata M , Nasuhara Y, Sato A, Takahashi T, Homma Y, Kawakami Y: Expression of epidermal growth factor and epidermal growth factor receptor immunoreactivity in the asthmatic human airway Am J Respir ... accumulation in the 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 airways of patients who died of severe asthma attack Chest 19 92, 11 01: 916 –9 21 Burgel P-R, Escudier E, Coste A, Dao-Pick T,...
- 5
- 375
- 0
Báo cáo y học: " Plasma soluble vascular endothelial growth factor receptor-1 levels predict outcomes of pneumonia-related septic shock patients: a prospective observational study" pot
... et al Critical Care 2 011 , 15 :R 11 http://ccforum.com/content /15 /1/ R 11 Page of 11 Figure Plasma soluble vascular endothelial growth factor receptor (sVEGFR1) levels and urokinase plasminogen activator ... 2008, 10 6 :18 20 -18 26 26 Vidal F, Aragonés J, Alfranca A, de Landázuri MO: Up -regulation of vascular endothelial growth factor receptor Flt -1 after endothelial denudation: role of transcription factor ... http://ccforum.com/content /15 /1/ R 11 Page 10 of 11 Table Univariate and multivariate analyses of predictive factors for the presence of concomitant multi-organ dysfunction Univariate analysis Multivariate analysis Variables...
- 11
- 205
- 0
Báo cáo y học: "Systems analysis of circadian time-dependent neuronal epidermal growth factor receptor signaling" pdf
... microarrays aRNA from the microarray samples and two additional daytime samples were used for qRT-PCR The analysis approach used for the qRT-PCR data was a combination of the '∆∆Ct' method [60] and ... cases where annotation was not available and clone IDs are given instead Images were created using the free Treeview program [62] Additional data file displays the relativeanimal-animal variability ... Pharmacia Biotech, Piscataway, NJ, USA) using the indirect aminoallyl-dNTP approach Experimental details for microarray hybridization, scanning, and quantification are in Additional data file...
- 15
- 312
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose