in the exceptional event that a provision has not been recognised in the balance sheet because this could not be estimated reliably the reasons why such an estimate cannot be made
Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt
... nuclear extracts were incubated with avidin–agarose beads (Sigma) at °C for 30 to eliminate materials in the extracts that bind nonspecifically to the beads After removing the beads by filtration, ... Edman degradation [51,52] EMSA supershift assays (Fig 5B) and immunoblot analyses (Fig 5A) using mAbs specific to human Ku-70 and Ku-80 revealed that the MREa-binding proteins described herein and ... performed using LA Taq (Takara, Japan) in a total volume of 50 lL containing 55 pg of competitor At this concentration, the band intensity of the amplified product from the competitor was same as that...
- 11
- 628
- 0
Tài liệu Báo cáo Y học: Analyses of the CYP11B gene family in the guinea pig suggest the existence of a primordial CYP11B gene with aldosterone synthase activity docx
... all lines independently It seems, however, much more likely that the gene was duplicated in an ancestor mammal In this respect, it is interesting that analyses in the frog as an amphibian gave ... contrast, the distance matrix algorithms again placed the guinea pig together with artiodactyls and primates, thus supporting paraphyly albeit only with bootstrapping probabilities between 49 and ... proteins of other species than CYP11B1 of the guinea pig (compare lines A and B) Together these results suggest that the CYP11B2 genes are the primordial genes and that a common ancestor containing...
- 9
- 671
- 0
Báo cáo khoa học: Replacement of two invariant serine residues in chorismate synthase provides evidence that a proton relay system is essential for intermediate formation and catalytic activity docx
... (Ser16Ala and Ser127Ala) and a double-mutant protein (Ser16AlaSer127Ala) In this article, we report that the replacement of both invariant serine residues (Ser16AlaSer127Ala double-mutant protein) ... Single-mutant proteins in which Asp367 has been replaced with alanine or asparagine exhibit a 300- and 600-fold lower activity, respectively, emphasizing the important role of the Asp367 residue as an ... phosphateleaving group to facilitate C–O bond breakage Results Expression and purification of the Ser16Ala and Ser127Ala single-mutant proteins and of the Ser16AlaSer127Ala double-mutant protein The mutant...
- 10
- 398
- 0
Báo cáo khóa học: Disruption of the interaction between the Rieske iron–sulfur protein and cytochrome b in the yeast bc1 complex owing to a human disease-associated mutation within cytochrome b potx
... samples, inhibited the activity in samples from the patient This was in agreement with the data obtained in this study, using the mutant yeast enzyme It has been reported that a mutation in the ... could be excluded, because the addition of an equal amount of decylubiquinone to decylubiquinol at the beginning of the assay had no effect on the kinetics (data not shown) It is more probable that ... variations in the ISP content were observed between different mitochondrial membrane preparations (data not shown) This could be a result of the instability of the mutant enzyme and an increased...
- 7
- 498
- 0
ENVIRONMENTAL INDICATORS: A SYSTEMATIC APPROACH TO MEASURING AND REPORTING ON ENVIRONMENTAL POLICY PERFORMANCE IN THE CONTEXT OF SUSTAINABLE DEVELOPMENT pot
... normalized so that an index of one indicates that the increase in man -made capital is offset exactly by the depreciation of the nation's natural assets An index much less than one indicates that resource ... development planners and others eager to improve the sustainability of land use and land management practices should find these maps invaluable At any rate, efforts to develop such map-based indicators ... construction, and manufacturing (including mining) Pollutants, waste, and materials dissipation stem mainly from manufacturing (including mining), energy production and consumption, agriculture, the transport...
- 58
- 698
- 0
Gradual phase and morphology transformation of Fe3O4nanoparticles to a - FeOOH nanorods in alcohol/water mediain the presence of surfactant F127
... It reveals the coexistence of two phases in the product From the above results, a gradual phase transformation from Fe3O4 to a- FeOOH can be seen with increasing volume ratios of alcohol/water Fig ... precipitate suspended steadily in solution When the solution was aged in air, a color change from black to yellow was observed, starting from the interface between solution and air This could be attributed ... in pure water and in alcohol/water media is also investigated, as shown in Fig The value of saturation magnetization of samples a, b, and c is 75.4 emu/g (Fig 3a) , 39.2 emu/g (Fig 3b), and (Fig...
- 4
- 658
- 0
Báo cáo khoa học: Functional importance of a conserved sequence motif in FhaC, a prototypic member of the TpsB/Omp85 superfamily ppt
... density map and are not included in the final model Structural data are available in the Protein Data Bank database under the accession number 3NJT Overlay assay Channel analysis Fha30 is a 30-kDa, ... blot with an anti-FhaC serum This antibody was raised in rats against the periplasmic domain of FhaC and prepared by Eurogentec (Seraing, Belgium) The amounts of Fha44 and FhaC were quantified by ... following primers : R450AUp (5¢-GACGAGTACACGGT GGCCGGATACAACCTCAGGA-3¢) and R450ALo (5¢-TC CTGAGGTTGTATCCGGCCACCGTGTACTCGTC-3¢); Y452AUp (5¢-ACACGGTGCGCGGAGCCAACCTCAAG ACGTC-3¢) and Y452ALo (5¢-GACGTCCTGAGGTTGG...
- 11
- 396
- 0
Báo cáo khoa học: The ‘pair of sugar tongs’ site on the non-catalytic domain C of barley a-amylase participates in substrate binding and activity potx
... of an N-terminal catalytic (b a) 8-barrel (domain A) , a domain B, protruding between b-strand and a- helix 3, and a C-terminal antiparallel b -sheet domain-C [3,4] The isozymes show functional and ... secondary carbohydrate-binding sites that are not part of the active site area but which are situated on the surface of the catalytic domain or an intimately associated domain rather than on a CBM, ... very large and may reect that only a few a- glucan chains in the granules are readily hydrolyzed or that a major fraction of the products remains associated with the granules The trend of an even...
- 13
- 385
- 0
Báo cáo khoa học: A L225A substitution in the human tumour suppressor HIC1 abolishes its interaction with the corepressor CtBP docx
... mutagenesis (mCtBP2 .A5 8E.F, GACCTGGCCACTGTGGAATTCTGTGATGCACAG; mCtBP2 .A5 8E.R, CTGTGCATCACAGAATTCCACAGT GGCCAGGTC; mCtBP2.V72R.F, GAAATCCATGAGA AGCGGTTGAATGAAGCTGTG; and mCtBP2.V72R.R, CACAGCTTCATTCAACCGCTTCTCATGGATTTC) ... For example, GATA2 KI ⁄ KI mice carrying a Val-to-Gly point mutation in the GATA2 N-terminal zinc finger that ablates the interaction with cofactors of the Friend of GATA (FOG) family have been ... and immunoprecipitates (lanes 1–6) were analysed as described above with the CtBP2 or HIC1 (325) antibodies tranfection assays in mammalian cells, these two point mutants are unable to interact...
- 12
- 326
- 0
Báo cáo khoa học: HIP/PAP, a C-type lectin overexpressed in hepatocellular carcinoma, binds the RIIa regulatory subunit of cAMP-dependent protein kinase and alters the cAMP-dependent protein kinase signalling ppt
... indicates that the location of HIP/PAP and RIIa is consistent with the relevance of their interaction HIP/PAP has been classified in the group of C-type lectins because it binds lactose and contains ... expressing human HIP/ PAP in the liver, HIP/PAP enhances liver regeneration and acts as a hepatic cytokine that combines mitogenic and anti-apoptotic functions using pathways involving PKA [16] In ... HIP/PAP is a substrate for PKA (A) Recombinant HIP/PAP was incubated for 30 at 30 °C with the catalytic subunit of PKA and 100 lM [32P]ATP[cP] in 80 lL as described in the Materials and methods Aliquots...
- 9
- 310
- 0
Báo cáo khoa học: A cryptochrome-based photosensory system in the siliceous sponge Suberites domuncula (Demospongiae) docx
... underlined): attB1_SP ⁄ Crypto_dom 5¢-GGGGACAAGTTTGTACAAA AAAGCAGGCTTAGAGTTTGCACTCTATACG-3¢ and attB2_ASP ⁄ Crypto_dom 5¢-GGGGACCACTTTGTACAA GAAAGCTGGGTACTATTGCCTGATTTGACGTAT-3¢ at an initial denaturation ... l-arabinose as the transcription-inducing agent The bacterial crude extract was prepared and analyzed by SDS ⁄ PAGE (Fig 4A) In l-arabinose-induced samples (Fig 4A, lane a) , as well as in noninduced ... of Arabidopsis thaliana The tree revealed a distinct branch near the root that contained all members of the class II photolyases, including distantly related bacterial enzymes By contrast, the...
- 20
- 338
- 0
báo cáo sinh học:" Health workforce attrition in the public sector in Kenya: a look at the reasons" ppt
... Geoffrey Kimani for assisting with the management of data collection, Nancy Pielemeier for guidance of the research and Ann Lion and Marc Luoma for review of an earlier draft We appreciate the support ... sub-Saharan Africa: the pivotal role of the UK Lancet 2005, 365:1893-1900 Pang T, Lansang M, Haines A: Brain drain and health professionals BMJ 2002, 324:499-500 Vujicic M, Zurn P, Diallo K, Adams ... nurses was substantially higher than that of registered nurses, the number of clinical officers in district and provincial general hospitals was about the same as the number of doctors in these facilities...
- 8
- 494
- 0
báo cáo hóa học:" Can the surgical checklist reduce the risk of wrong site surgery in orthopaedics? - can the checklist help? Supporting evidence from analysis of a national patient incident reporting system" pptx
... decision making, communication and teamwork and leadership Other high-risk industries such as aviation and petroleum have made great progress in managing these challenges and have reduced harmful events ... protecting against error have failed; there is an accident waiting to happen [31] The capacity to defend against the potential for minor mishaps having a cumulative effect and escalating into more ... of the manuscript BP made substantial contributions to the acquisition and analysis of the data and drafted the earlier versions of the manuscript BM made substantial contributions to the interpretation...
- 7
- 443
- 0
báo cáo hóa học:" Can the surgical checklist reduce the risk of wrong site surgery in orthopaedics? - can the checklist help? Supporting evidence from analysis of a national patient incident reporting system" pdf
... decision making, communication and teamwork and leadership Other high-risk industries such as aviation and petroleum have made great progress in managing these challenges and have reduced harmful events ... protecting against error have failed; there is an accident waiting to happen [31] The capacity to defend against the potential for minor mishaps having a cumulative effect and escalating into more ... of the manuscript BP made substantial contributions to the acquisition and analysis of the data and drafted the earlier versions of the manuscript BM made substantial contributions to the interpretation...
- 7
- 507
- 0
báo cáo hóa học:" Serous papillary adenocarcinoma possibly related to the presence of primitive oocyte-like cells in the adult ovarian surface epithelium: a case report" docx
... a classical histological analysis, and diagnosed the ovarian cancer All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests ... among ovarian cancers Ovarian cancers account for percent of all cancers among women according to the American Cancer Society The five-year survival rate in women with advanced ovarian cancer is 15 ... pathological state leading to the manifestation of ovarian serous papillary adenocarcinoma It has been confirmed that teratoma and other germ cell tumors can be formed from oocytes/ parthenogenetic...
- 5
- 406
- 0
báo cáo hóa học: " Improvement in health-related quality of life after therapy with omeprazole in patients with coronary artery disease and recurrent angina-like chest pain. A double-blind, placebo-controlled trial of the SF-36 survey" ppt
... disappearance on an increase in SF-36 score [1,29,36] However, it should be underlined that our results cannot be applied in all patients with CAD and refractory anginalike symptoms, mainly because ... original study, and took part in the acquisition of data and their analysis and interpretation All authors read and approved the final manuscript 12 13 14 15 16 17 18 Competing interests The authors ... outpatients with CAD-11 female (23%) and 37 male (77%)-diagnosed with recurrent stable angina-like chest pain refractory to standard anti-angina therapy and without indications for revascularization...
- 9
- 483
- 0
báo cáo hóa học:" Research Article Entire Solutions for a Quasilinear Problem in the Presence of Sublinear and Super-Linear Terms" potx
... Boundary Value Problems The class of problems 1.1 appears in many nonlinear phenomena, for instance, in the theory of quasiregular and quasiconformal mappings 1–3 , in the generalized reaction-diffusion ... Applications, vol 200, no 2, pp 498–505, 1996 13 A V Lair and A W Shaker, “Classical and weak solutions of a singular semilinear elliptic problem,” Journal of Mathematical Analysis and Applications, ... Brezis and S Kamin, “Sublinear elliptic equations in RN ,” Manuscripta Mathematica, vol 74, no 1, pp 87–106, 1992 11 H Brezis and L Oswald, “Remarks on sublinear elliptic equations,” Nonlinear Analysis:...
- 16
- 438
- 0
Holcim has strengthened its balance sheet and earning power and positioned itself as an attractive group in the international capital markets
... the Thi Vai the increase in cement sales Newly acquired quarries in the grinding facility in Vietnam, which has an annual capacity of Canadian province of Ontario led to a 2.6% increase in sales ... amortized but be subject to At each balance sheet date, the Group assesses whether there an annual impairment test is any indication that an asset may be impaired If any such indication exists, the recoverable ... disclosures at the date of the financial statements exchange rates prevailing at the date of the transactions; These estimates are based on management’s best knowledge of gains and losses resulting from...
- 86
- 257
- 0
Báo cáo lâm nghiệp: " Effects of ectomycorrhizal inoculation and the type of substrate on mycorrhization, growth and nutrition of containerised Pinus pinea L. seedlings produced in a commercial nursery" docx
... improve not only the growth of the seedling but also their physiological status by enhancing the photosynthetic capacity [11] and by increasing the uptake of water and nutrients, and their accumulation ... Tarragona, Spain) Nursery production of containerised P pinea 819 Table II ANOVA significance levels for the factors inoculation (A) and type of substrate (B), and interaction between them (AB) ... parts such stem and roots as well as the mantle and the external mycelium produced by the fungus may act as nutrient storage structures and should be taken into account in a global nutrient balance...
- 6
- 509
- 0
Báo cáo toán học: "On the number of subsequences with a given sum in a finite abelian grou" pptx
... but not in T2 By Claim A, we have that c is in another Ti , say Tr+2 and so not in any of T3 , T4 , , Tr+1 Again Sc−1 contains exactly r disjoint minimal zero-sum subsequences, which are ... Non-unique factorizations, Combinatorial and Analytic Theory, Pure and Applied Mathematics, vol 278, Chapman & Hall/CRC, 2006 [15] A Geroldinger, Additive group theory and non-unique factorizations, ... groups Notation and lower bound Our notation and terminology are consistent with [10] We briefly gather some notions and fix the notation concerning sequences over abelian group Let N and N0 denote the...
- 10
- 360
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008