in the absence of a s
Báo cáo sinh học: " Clearance of low levels of HCV viremia in the absence of a strong adaptive immune response" pptx
Ngày tải lên :
18/06/2014, 18:20
... ELISA-assay remained negative throughout follow-up in of the seven cases (Table 1) We also investigated reactivity against single HCV proteins by the INNO-LIA HCV III assay A faint band against ... shown in figure 1) At least one HCV protein was reactive in (22%) of the ELISPOT-assays and (16%) of the proliferation assays (table 6) In cases (37%) any of the two CD4 assays yielded at least ... responses in 5/12 assays and proliferative responses in 3/9 assays performed with samples from individuals also with a similar strength in responses (table 6) HCV-specific CD8+ T cell responses...
- 11
- 528
- 0
Báo cáo hóa học: " Clearance of low levels of HCV viremia in the absence of a strong adaptive immune response" potx
Ngày tải lên :
20/06/2014, 01:20
... ELISA-assay remained negative throughout follow-up in of the seven cases (Table 1) We also investigated reactivity against single HCV proteins by the INNO-LIA HCV III assay A faint band against ... shown in figure 1) At least one HCV protein was reactive in (22%) of the ELISPOT-assays and (16%) of the proliferation assays (table 6) In cases (37%) any of the two CD4 assays yielded at least ... responses in 5/12 assays and proliferative responses in 3/9 assays performed with samples from individuals also with a similar strength in responses (table 6) HCV-specific CD8+ T cell responses...
- 11
- 440
- 0
Báo cáo y học: "Candida albicans genome sequence: a platform for genomics in the absence of genetics" potx
Ngày tải lên :
09/08/2014, 20:20
... patients [18], whereas the main focus of C albicans and C dubliniensis infections is the kidneys [5] Also, A fumigatus has evolved as a saprophyte, decomposing leaf litter, whereas C albicans appears ... What can be gleaned from the genome sequences of a pathogen such as C albicans (and from other related fungi)? C albicans has rarely been isolated in nature away from an animal host and has probably ... the fission yeast Schizosaccharomyces pombe These genes are of particular interest to those interested in fungus-host interactions, because many might play roles in the infection process The genome...
- 3
- 400
- 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System
Ngày tải lên :
12/09/2012, 15:05
... process operating within a task; its only physical attribute is its processing state (e.g., program counter and registers) All threads within a task share the address space and capabilities of that ... data objects Messages may contain port capabilities or imbedded pointers as long as they are properly typed A single message may transfer up to the entire address space of a task msg_send(message, ... storage Instead of basing secondary storage around a kernel-supplied file system (as was done in Accent and Aegis), Mach treats secondary storage objects in the same way as other server-provided resources...
- 23
- 1.3K
- 1
Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model
Ngày tải lên :
06/09/2013, 05:48
... behavioral and attitudinal aspects of individuals An in- depth analysis in each of the broad parameters revealed the following: Educational Facet Education plays a vital role in shaping up a personality ... by the MFIs to obtain loan as sustainability of the job is not secured High inflation rate in Pakistan also deepens the misery of the labor class, which has no other alternative to increase their ... possesses some form of social class which is important to the MFIs because the behavior of people in a given social class is similar In this way financing activities could be tailored according...
- 23
- 552
- 0
Tài liệu “Measuring customer satisfaction in the context of a project-based organization” docx
Ngày tải lên :
15/01/2014, 15:59
... company s products and services are assessed Overall satisfaction is then assessed on the performance scores of various attributes Both of these methods have their strengths and weaknesses, which ... customer satisfaction and financial performance Indirect measures of customer satisfaction provide simple ways of assessing the state of customer satisfaction They not consume very much of the suppliers ... measurement of CS includes the identification of key individuals and their relative importance and the measurement / assessment of each key individual s satisfaction or dissatisfaction and the...
- 37
- 1.1K
- 0
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx
Ngày tải lên :
19/02/2014, 16:20
... unstable in the absence of any of the ND subunits (V79-G7), or in the absence of the ESSS subunit (V79-G18) Strikingly, the PSST subunit is also unstable in absence of ESSS subunit, although these ... mitochondrial protein synthesis takes place, and all the ND subunits are missing In all of these mutants ESSS-HA is still accumulated to near normal levels (Fig 6) This behavior contrasts strongly ... that of the MWFE subunit It is possible that the ESSS-HA subunit is stable in isolation, but there are indications that ESSS-HA interacts with at least one other nuclear-encoded subunit Cross-linking...
- 9
- 622
- 0
Tài liệu In the Shadows of a Fallen Wall docx
Ngày tải lên :
22/02/2014, 06:20
... In actuality, this conversation never took place Because of the weather, seating was abundant and the table next to us that evening was empty And it was because of the weather that the Lindes ... witnesses (or has witnessed) but who also questions upon seeing, one whose trigger finger works a keyboard, a paintbrush, or a camera rather than a gun During our stay, I ran across Brian Rose s The ... light s overstimulation The greater the contrast between light and darkness, the longer this adjustment takes In the Shadows of a Fallen Wall captures some of those instances when I paused in the...
- 208
- 481
- 0
Báo cáo Y học: Inhibition of the SERCA Ca21 pumps by curcumin Curcumin putatively stabilizes the interaction between the nucleotide-binding and phosphorylation domains in the absence of ATP pot
Ngày tải lên :
08/03/2014, 23:20
... catalytic site is also possibly increased In order to further assess the possibility of curcumin affecting the interaction of ATP binding to the ATPase, this was directly measured using [32P]ATP ... presence of curcumin, using the coupled enzyme assay In Fig 3A, the half-maximal activation of the ATPase by Ca2þ was measured in the absence of and in the presence of 10 and 25 mM curcumin The EC50 ... -isothiocyanate FITC-labelled Ca21-ATPase Ca21-ATPase activity Ca2þ-ATPase activity determination in microsomes was performed using the phosphate liberation assay as described by Longland et al [22]...
- 10
- 594
- 0
Báo cáo khoa học: Catalytic mechanism of the primary human prostaglandin F2asynthase, aldo-keto reductase 1B1 – prostaglandin D2 synthase activity in the absence of NADP(H) pptx
Ngày tải lên :
14/03/2014, 23:20
... substrate PGH2 and Vmax values of PGFS and PGDS activities of AKR1B1 and AKR1B3 suggest that the substrate is bound in a similar fashion Mutagenesis analyses of the effect of the AKR tetrad in ... observation that Km for NADP+ is significantly altered in these mutants also suggests that Lys77 and Asp43 may have roles in NADPH binding as well as catalysis The hypothetical catalytic mechanisms ... of PGDS and PGFS activities of AKR1B1 are shown schematically in Fig In the absence of NADPH, the concerted reaction of Asp43, Lys77 and His110 increases the basicity of His110 and extracts the...
- 11
- 390
- 0
Incidents in the Life of a Slave Girl Written pdf
Ngày tải lên :
15/03/2014, 03:20
... and it is seldom that they not make them aware of this by passing them into the slave-trader 's hands as soon as possible, and thus getting them out of their sight I am glad to say there are some ... plantation, but in a town not so large that the inhabitants were ignorant of each other 's affairs Bad as are the laws and customs in a slaveholding community, the doctor, as a professional man, ... family My father, by his nature, as well as by the habit of transacting business as a skillful mechanic, had more of the feelings of a freeman than is common among slaves My brother was a spirited...
- 196
- 462
- 0
Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot
Ngày tải lên :
16/03/2014, 23:20
... enzymes has increased dramatically over the past several years as a result of successes in the structural elucidation of a number of enzymes in this class by X-ray crystallography This structural information ... molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated average molecular mass of 87 392 Da The total calculated average molecular mass of the heterotetrameric (a2 b2) ... (gcccagtacctacaagattc) Localization of xdhAB genes on the C acidovorans plasmid was established using the AlkPhos Fig Location of the xdhAB gene operon on an isolated Comamonas acidovorans plasmid...
- 11
- 584
- 0
Báo cáo Y học: Expression pattern in the antennae of a newly isolated lepidopteran Gq protein a subunit cDNA potx
Ngày tải lên :
17/03/2014, 23:20
... tetrazolium as substrate The affinity purified Gq/11 a antiserum was raised against a synthetic decapeptide corresponding to the C-terminal of a G protein a subunit and cross-reacts with the a subunits ... protein of the compound eyes Expressed in nervous tissues Expression in ORN Expression in neurons of olfactory organs and brain Expression in eyes Expression in visual cells Expression in neurons ... with other already known Gq protein a subunits and therefore can be placed within this family Indeed, M brassicae Gqa possesses all the characteristics observed in Gqa-like proteins In particular,...
- 10
- 619
- 0
Báo cáo khoa học: Kinetic analysis of zymogen autoactivation in the presence of a reversible inhibitor pptx
Ngày tải lên :
23/03/2014, 13:20
... period, a rapid increase in trypsin activity was observed The lag phase of the S- shaped activation curve is shortened by an increase in the trypsinogen concentration, and the maximal trypsin activity ... ions the autocatalytic activation of trypsinogen is quantitative and therefore calcium ions almost totally suppress hydrolysis of certain other linkages, which in the absence of calcium are responsible ... intermolecular autocatalytic process The conversion of trypsinogen to trypsin involves the removal of the N-terminal hexapeptide H2N-Val-AspAsp-Asp-Asp-Lys [28] This process is strongly stimulated by calcium...
- 8
- 403
- 0
Báo cáo khoa học: "Current Research in the Development of a Spoken Language Understanding System using PARSEC*" ppt
Ngày tải lên :
23/03/2014, 20:20
... prosodic information is added as constraints instead of incorporating it into a parsing grammar Because CDG is more expressive than context-free grammars, we can produce prosodic rules that are ... imposed by natural language systems developed primarily for textbased applications, such as repeated words and false starts of phrases In addition, we believe that prosody will help to resolve the ... processing time is incremented by this amount In contrast, Bear and Price, by doubling the size of the grammar are multiplying the processing time by a factor of when no prosodic information is available...
- 2
- 359
- 0
Báo cáo khóa học: Protein assembly of photosystem II and accumulation of subcomplexes in the absence of low molecular mass subunits PsbL and PsbJ pdf
Ngày tải lên :
30/03/2014, 13:20
... particular, some of the PSII core proteins and all of the OEC proteins can accumulate in thylakoids in the absence of any assembly of PSII, as was evident for the DpsbE and DpsbF tobacco mutants (Fig ... despite the absence of PsbJ, whereas in the absence of PsbL the PSII core proteins accumulated in minor amounts and successfully assembled only into PSII core monomers with unstable association of ... mutual regulation of the accumulation of PsbW and the other PSII core proteins was also evident in psbW antisense mutants of Arabidopsis [8] All this suggests that PsbW is not under the same strict...
- 12
- 401
- 0
báo cáo hóa học: " Cognitive interviewing methodology in the development of a pediatric item bank: a patient reported outcomes measurement information system (PROMIS) study" docx
Ngày tải lên :
18/06/2014, 19:20
... domains that are important across a variety of illnesses, including physical function, pain, fatigue, emotional distress, and social function [2] Since asthma is the most common chronic disease ... as young as years could respond to items and talk about all aspects of their health and well-being in meaningful ways They are able to comprehend varying response options on a categorical scale, ... San Francisco: Jossey-Bass; 1996 Schwarz N, Sudman N, (eds): Answering questions: Methodology for determining cognitive and communicative processes in survey research San Francisco: Jossey-Bass;...
- 10
- 480
- 1
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot
Ngày tải lên :
18/06/2014, 22:20
... and REC-type S RNA was monitored on ten sequential passages of the mixture of TULV02 and RecTULV5 variants (Fig 2) S RNA of V-type was seen on all passages (Fig 2A, lines 1–10) In contrast, S ... "immature" status When, under similar experimental settings, TUL02 has been passaging in the presence of another isolate, TULV/Lodz, none of the two viruses was able to establish a dominance during ... presence of the two different types of S RNA using specific primer pairs at the stage of nested PCR gave exactly the same result The V-type S RNA was detected during all ten passages while the...
- 5
- 483
- 0
báo cáo hóa học: " Application of a hybrid wavelet feature selection method in the design of a self-paced brain interface system" pptx
Ngày tải lên :
19/06/2014, 10:20
... Such signals can be used to label the brain signals and to evaluate the performance of a BI The data analysis of individuals with motor disabilities was thus left to future studies The data of four ... The training set was used to train the classifier, and the validation set was used to select the best set of features The configuration yielding the best results on the validation set in the multi-objective ... training set data were calculated Then, using histograms with 10 bins each, the probability function of each feature was estimated and its mutual information with each of the output classes was...
- 13
- 530
- 0