... fromthe tails ofthe WLCCsurr distribution, (5) the generated surrogates have the same amplitude information as Y but their phases are randomized The null hypothesis is thatthe results related ... amplitude and phase ofthe time series Therefore, we cannot detect the nature ofthe relation by using the wavelet coherence The aim of this work is to separate the two kinds of information (phase and ... identifying the nature ofthe relation between EHG signals, we choose to use two different methods that focus on separate aspects ofthe relationship between the signals, namely, the phase and the amplitude...
... in the value of DCm It is important to recognize therefore that denaturation midpoints in the presence of half-saturating levels of sulfate were identical within the experimental error for the ... stabilities; and thatthe Arg fi Ala replacement at position 242 offsets the stabilizing effect of sulfate binding in the wild-type to the extent that this mutation stabilizes the enzyme when no sulfate is ... artifact ofthe protein folding process in the E coli cytosol, the conversion ofthe tetramer into its constituent dimers must take place at a slow rate The data suggest thatthe use of amino-terminal...
... deceived, therefore, by any changes that are produced in waterWater is the same everywhere, whether produced fromthe ocean or fromthe flame ofthe candle Where, then, is this water which we get from ... take a towel to wipe off the water; and it is by that kind of wetting, or that kind of attraction which makes the towel become wet with water, thatthe wick is made wet with the tallow I have known ... have one ofthe most beautiful illustrations ofthe general nature of a candle that I can possibly give The fuel provided, the means of bringing that fuel to the place ofchemical action, the regular...
... been suggested that a fine regulation of root water uptake is provided by water channels (aquaporins) in the cell-to-cell passage ofwater flow in roots [7, 45] Opening and closing ofthe channels ... the root is monitored at time intervals of 15 s with two sets of thermocouples and a thermopile Axial water flow in the root is calculated for 15-min averages by solving the heat balance equation ... ofthe studied branch roots to obtain a crude estimate ofthewater potential atthe root surface (Ψsurface) The tensiometer data were taken every 15 and averaged over the three instruments The...
... all fish that died in the different groups were positive for presence of VHS virus If the fish that were negative for presence of VHS virus are removed fromthe mortalities the pattern of mortality ... other pathogens that could explain the mortalities ofthe fish that were negative for presence of VHS virus None ofthe fish in groups V (N = 11) and KV (N = 16) were positive for VHS virus at ... for further transmission ofthe virus [36] In this study the number of VHS virus positive fish was few atthe termination ofthe experiment At day 53 only out of a total of 96 survivors from all...
... inactivates proteases that initiate the apoptotic pathway In addition, Akt phosphorylates the inhibitor of kappa B (IκB), promoting its degradation and permitting the nuclear translocation of nuclear ... differentiation However, it has been estimated that more than 70% of 12 osteoblasts atsitesof bone formation undergo apoptosis (Jilka et al., 1998) Therefore, it has been proposed that inhibiting ... dynes/cm2) of media across the surface ofthe bone cells The main advantage of using of an oscillatory pump to induce fluid shear stress is the controllable and uniform flow pattern that it produces...
... that influence the desired level of cash • Learn two models that calculate the optimal level of cash • Gain an overview of what factors/areas are inputs to a cash budget and how they affect the ... • Learn about the Cash Cycle • Understand the factors that influence the desired level of cash • Learn two models that calculate the optimal level of cash • Gain an overview of what factors/areas ... maintained in a location separate from cash & checks • Certification of vouchers Collection of funds Need for accelerating collections How to accelerate collection of receivables Disbursement of funds...
... Koschate (2005) stated that consumer satisfaction has a positive relationship with price acceptability and readiness to pay Fromthat research, these author want to say that higher consumer satisfaction ... design a Data collection (Secondary and Primary data collection) Primary data is information which the author gather by himself and secondary data is information gathered by others sources such ... increased There must be several key reasons for that Therefore, this research will be focused solely on identifying the causes ofthat situation, and then offering some suggestion to overcome the difficulties...
... Table Chemical (inorganic and organic) and isotopic compositionof selected water samples fromOSPER site B continued Table Important water- mineralinteractionsatOSPERsitesthatmodifythechemical ... compositionthat are comparable to thatofthe produced water source (Fig 7) The salinity ofwater obtained fromthe boreholes in the adjacent pit, which has more weathered and degraded oil (18), and from ... showing the salinity ofwater and the relative concentrations of major cations and anions in a transect fromthe BA-02 well to well BE07, located in the littoral zone of Skiatook Lake atthe OSPER...
... derived from mutagenesis studies, indicating thatthe docking simulations probably provide an accurate view ofthe molecular basis ofthe interaction PnIB determinants are located lower in the ACh ... regions fromthe template to the target sequence; (b) generate random loops for the insertions/ deletions (or use a structural database search); (c) assign the coordinates ofthe chosen loop to the ... close to the outer perimeter ofthe muscle nAChR at a ˚ distance of 39–45 A fromthe membrane surface [9] This was later confirmed by the electron microscopy ofthe ˚ Torpedo receptor at 4.6 A...
... group ofthe enzyme A hydrophobic interaction ofthe side chain of Met1 of Tat(1–9) with the phenyl ring ofthe substrate Ala-Pro-pNA resulted in a fixation ofthe aromatic leaving group Rather ... Tat(1–9), the binding affinity of a second inhibitor molecule of Gly3Tat(1–9) or Trp1-Tat(1–9) to the EI complex was decreased On the other hand, in the case of Ile3-Tat(1–9) the formation ofthe ... oxygen atom ofthe side chain carboxylic group of Glu668 and between the carbonyl carbon atom of Pro ofthe substrate Ala-Pro-pNA and the Ser630 oxygen atom ofthe enzyme to hold the substrate inside...
... suggests that K527-conjugation enhances the efficiency of sumoylation atthe other site A third line of independent evidence for sumoylation of c–Myb is the interaction between c-Myb and Ubc9, the latter ... to modification at two residues in the NRD part ofthe protein with K527 being the major sumoylation site The conjugation of SUMO-1 to c-Myb raises the question ofthe role of this modification with ... Biochem 270) matrix preparation experiment (Fig 6) This experiment also showed that there is an accumulation of sumoylated Myb in the insoluble fraction ofthe nucleus, indicating that sumoylation stabilizes...
... reared at 23 °C in recirculating UV-treated tap wateratthe ÔDe Haar VissenÕ facility in Wageningen Fish were fed dry food pellets (Provimi, Rotterdam, the Netherlands) at a daily ration of 0.7% of ... GAGGAGGACCACCATGCATCT TTGTGCAAGCAGTCCAGAAAGA GGATGCAGGCAATACTCCTG CCATACTGCCAAGAAAAGATGAT ACAGAGGCATACAAGTGCAGATG TGTTTAGGCTTGATCTCCAGCTT CTGGGATTCCTGACCATTGGT GTTGGCTCTCTGTTTCAATGCA GGGCAGGTGTTTTTGTGTTGA ... predominates in brain and ovary [10], a pattern that matches the expression of carp CXCL14 The expression of zebrafish CXCL14 in the vestibulo-acoustic system and atthe midbrain–hindbrain boundary at...
... half ofthesitesthat successfully achieved that start-up outcome and was not present in any sitesthat did not achieve that outcome Study Sample We include six sitesthat chose to start the ... lack of an estimate regarding the costs ofthe pre-implementation phase activities All sites stressed the value of these activities, but they also indicated that there was not clear information ... fidelity was the conflict between requirements ofthe funders ofthesites and the fidelity requirements ofthe FBP An example of this is in the area of data collection and reporting The State funded...
... GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATT GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG GGGCGGATCCTCTGCTTTTCTTTATC CTGGACACAGCCACGCAGTATACAGCATACTATAACGG CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG ... Our data also show that, when molar equivalent amounts of Vps4p interactors are compared, the amount of Vps4p that binds to Did2p is greater than that bound by any ofthe other interactors These ... whether there is any correlation between the binding sites on Vps4p and the response ofthe interacting proteins to ATP binding and hydrolysis, we determined the region of Vps4p that mediates...
... ofthe continuity ofthe function qn1j on (0, R) In such a case, the ˜ n satisfy the equation ln (qn2j ) = For the same ˜ elements ofthe second row of matrix Q ˜ reason as above, we obtain that ... uniqueness ofthe solution of problems (12), (17), and (18) What is the structure ofthe solutions of system (12) that increase slower than r-2n-1 in the case where n does not satisfy the condition ... Theorem Let relation (5) hold, and let natural k, ≤ k ≤ s - 1, be such that ak+1 ≤ (k) (k) n ak Then, there exists a unique matrix solution Qn (r) = qnij (r) of Equation 12 such that relation (21)...
... motion ofthe first In this way, they measured the lifetime of T7 RNAP bound to the promoter, from which they could obtain the dissociation rate constant koff In some DNAbinding events that lasted ... The tension on the DNA was calculated fromthe measured values of Fmag and h They found thatthe extension versus force curve for a double stranded DNA molecule deviates fromthe prediction of ... is trapped atthe focal point ofthe laser, and the relationship between the displacement ofthe particle fromthe focal point and the applied force can be determined through a calibration procedure...