impact of a low field intraoperative mri on the surgical results for high grade gliomas
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... Spearmans coefficient (r) for non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods Results ... and after the initiation of NARP can be seen in table A negative correlation was observed between the ceftriaxone consumption and the prevalence of ceftriaxone resistant E.coli and Klebsiella ... financial cost and resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases, and 2) International...
- 6
- 692
- 0
The impact of a cancer Survivorship Care Plan on gynecological cancer patient and health car provider reported outcomes (ROGY Care): study protocol for a pragmatic cluster randomized controlled trial potx
... interpersonal skills, information provision, and availability; the other hospital staff’s interpersonal skills and information provision scale; the exchange of information single-item scale; the waiting ... for instance wishes for more information The questionnaire contains the following scales: (a) Information about the disease; (b) Information about medical tests; (c) Information about treatment; ... questionnaire aims to evaluate the (satisfaction with) information received by cancer patients on different areas of the disease, diagnosis, treatment and care, and some qualitative aspects, for...
- 8
- 786
- 0
báo cáo hóa học: " Impact of a child with congenital anomalies on parents (ICCAP) questionnaire; a psychometric analysis" pptx
... to the data analysis, the interpretation of the data and drafted the manuscript MD and HJD contributed to the statistical analysis, the interpretation of the data and helped to draft the manuscript ... can thus be evaluated Abbreviations CA: Congenital Anomaly; MCA: Multiple Congenital Anomalies; CDH: Congenital Diaphragmatic Hernia; ICCAP: Impact of a Child with Congenital Anomalies on Parents ... Primary anomalies Abdominal wall defect Congenital diaphragmatic hernia Small intestinal anomaly Oesophageal atresia Anorectal malformation Hirschsprung's disease Miscellaneous Congenital anomalies...
- 10
- 508
- 0
báo cáo hóa học:" Impact of a child with congenital anomalies on parents (ICCAP) questionnaire; a psychometric analysis" pot
... to the data analysis, the interpretation of the data and drafted the manuscript MD and HJD contributed to the statistical analysis, the interpretation of the data and helped to draft the manuscript ... can thus be evaluated Abbreviations CA: Congenital Anomaly; MCA: Multiple Congenital Anomalies; CDH: Congenital Diaphragmatic Hernia; ICCAP: Impact of a Child with Congenital Anomalies on Parents ... Primary anomalies Abdominal wall defect Congenital diaphragmatic hernia Small intestinal anomaly Oesophageal atresia Anorectal malformation Hirschsprung's disease Miscellaneous Congenital anomalies...
- 10
- 366
- 0
Báo cáo hóa học: " Research Article A Simulation Study: The Impact of Random and Realistic Mobility Models on the Performance of Bypass-AODV in Ad Hoc Wireless Networks" pdf
... repair the link break, the node broadcasts an RREQ for that destination Otherwise, the node makes a list of unreachable destinations consisting of the unreachable neighbor and any additional ... nonuniform distribution as the simulation time elapses and finally it reaches a steady state In steady state, the mobile nodes are concentrated at the central region and are almost zero around the ... randomly and uniformly from (0, Vmax ] Table shows the values of all parameters used in the simulation The following metrics are computed to evaluate the impact of each mobility model on the performance...
- 10
- 604
- 0
báo cáo khoa học: " A randomized trial to assess the impact of opinion leader endorsed evidence summaries on the use of secondary prevention strategies in patients with coronary artery disease: the ESP-CAD trial protocol" doc
... Atorva = atorvastatin; Prava = Pravastatin; Simva = simvastatin the EURopean trial On Reduction of cardiac events with Perindopril in stable coronary Artery disease (EUROPA)[34] and the Simvastatin/Enalapril ... system-related) are often responsible for the lack of implementation of proven efficacious therapies and traditional means of educating practitioners (journal articles, continuing medical education conferences, ... rates of statin use in the "control" arm of that trial[15] A meta-analysis of these trials confirmed that statins are clearly beneficial for secondary prevention in all subgroups of CAD patients,...
- 12
- 396
- 0
Tài liệu Ecology and Management of a Forested Landscape Fifty Years on the Savannah River Site pptx
... listing and conservation status of the mammals of the Savannah River Site 254 Table 4.25 Primary habitats of nongame mammals of the Savannah River Site 258 Table 4.26 Levels of foraging bat activity ... and transient and probably concentrated along bottomlands and terraces adjacent to streams (Sassaman et al 1990; Sassaman 1993) Sustained seasonal habitation of the area began between 9,800 and ... portion of the landscape (Edwards et al 2000) About two thirds of the upland forest areas are managed for this species and for the associated fire-maintained savanna conditions that support a great...
- 513
- 1,719
- 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), GLU H44 7A ... GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); GLU H44 7A, ... et al Glucoamylase raw starch binding site reverse (5¢-GTTCATTCAAGGAGCCATCAGCATTAAT AGCATCCAAAATGACTTGC-3¢) All mutations were verified by DNA sequencing Glucoamylase Glu Enzyme preparation and...
- 11
- 548
- 0
Báo cáo Y học: Characterization of a low redox potential laccase from the basidiomycete C30 pptx
... speculated from steady state analysis that laccases have a conserved O2 binding domain and that the rate of O2 reduction is dependent on that of substrate oxidation In our case, this means that LAC2 ... Grenoble, France) confirmed that only cDNA20, amplified with the reverse primer AK20 5¢CAGAGAACGAACGTA TGTGCTGG3¢ under the conditions described in the Marathon cDNa cloning kit manual, encodes the peptides ... Comparison of the backbone superposition at the T1 copper site of the C cinereus laccase and the C30 laccase models The Ca trace of C cinereus ( 1A6 5) laccase is shown in red For clarity, only...
- 7
- 616
- 0
Báo cáo khoa học: Atrial natriuretic peptide-dependent photolabeling of a regulatory ATP-binding site on the natriuretic peptide receptor-A pptx
... in the membrane preparation, as measured using a gamma counter Membrane preparations were then used in guanylyl cyclase assays A total of lg of membranes was incubated for 12 at 37 °C in the ... extracellular domain would induce a conformational change in the intracellular KHD This conformational change would allow ATP binding to the KHD Thus, preincubation of membranes with ANP should increase ... C-terminal 196 amino acids, forming the GC domain, by a Bpu1102I ⁄ KpnI co-digestion A synthetic linker (complementary oligonucleotides 5¢-TGAGCAACTCAAGAGA GGTGAAAGAGGCTCTTCTACACGTGGTTAAGGTA C-3¢ and 5¢-CTTAACCACGTGTAGAAGAGCCTCTTT...
- 12
- 338
- 0
Báo cáo hóa học: "The impact of psychosocial and organizational working conditions on the mental health of female cleaning personnel in Norway" doc
... considered a "case" [30] among the factors Data considerations and statistical assumptions were met: data was quantitative at the interval scale level with a normal distribution and the sample size ... dimensions, and work organization) and the risk of having an elevated HSCL-25 score Results demonstrated that fair and poor satisfaction with leadership had a significant association with mental health ... Working alone/in a pair/in a team Contact with colleagues at the workplace Contact with manager at the workplace Co-workers Time pressure/control Information/Knowledge Working alone/in a pair/in a...
- 10
- 457
- 0
Báo cáo y học: "Impact of drug classes and treatment availability on the rate of antiretroviral treatment change in the TREAT Asia HIV Observational Database (TAHOD" pdf
... treatment options are available The low rates of treatment changes on second and third combinations may reflect scarcity of affordable or available salvage options rather than durability of regimens ... rate of changes and has the same number of years of follow-up (2.3 years) [8,9,18] The rate of combination antiretroviral treatment change in The Australian HIV Observation Database (AHOD) was ... Previous analyses from the Australian HIV observational database (AHOD) showed that patients remain on their first treatment for a median 646 days (1.8 years) [9] The range of drug options available...
- 10
- 537
- 0
Báo cáo y học: "Impact of Attention-Deficit/Hyperactivity Disorder (ADHD) on prescription dug spending for children and adolescents: increasing relevance of health economic evidence" pot
... development Results of literature searches and the database analysis [49] are summarized in Table A number of further pharmaceutical preparations and variants of methylphenidate are in phase III of clinical ... total market data delineated in the Introduction (4) New product profiles and availability An extensive literature and database search was conducted to obtain information on the expected availability ... April 2006) of methylphenidate with duration of action of 12 hours (wear time, hours) At present, in the absence of head-to-head trials against established oral formulations, the main advantage...
- 17
- 509
- 0
Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc
... evaluation settings Their major drawback of evaluation is that they focus on the estimation of cash flows and accounting criteria (Kim, Suh and Hwang, 2003) Nevertheless, traditional performance ... information systems and data warehouses been able to manage a great deal of data The challenge is to capture and measure soft and qualitative information For example, in the book The Experience Economy ... predominantly classical ones We can find the explanation for this behaviour in the fact that these indicators are much easier to measure In addition, conventional methods have the advantage of being...
- 15
- 796
- 0
The Impact of a Corporate Culture of Sustainability on Corporate Behavior and Performance pptx
... nonfinancial information, such as engineering firms for environmental information and human resource supply chain consultants for social information, lack the global scale and full range of capabilities ... performance, both good and bad, and the relative emphasis it gives to traditional financial information compared to information on nonfinancial performance which could affect financial performance ... and safety The Thomson Reuters ASSET4 database provides data on the adoption or non-adoption of these policies, for at least one year, for 775 US companies, with complete data for fiscal years...
- 57
- 447
- 0
IMPACT OF MATERNAL AND CHILD HEALTH STRATEGY ON CHILD SURVIVAL IN A RURAL COMMUNITY OF PONDICHERRY pptx
... devised and made popular Training of traditional birth attendants and health worker females on neonatal resuscitation and neonatal care has been successfully field tested in Chandigarh, India(12) and ... early antenatal registrations Since the time of antenatal registration is determined by traditional customs in this area, repeated Information, Education and Communication (IEC) activities are ... Public Health Nurses for child care for the first three years The slower decline in the neonatal mortality is because of the mainly non-infective nature of the conditions causing neonatal deaths...
- 8
- 403
- 0
THE EXPOSURE OF YOUTH TO UNWANTED SEXUAL MATERIAL ON THE INTERNET: A National Survey of Risk, Impact, and Prevention pdf
... the American Medical Association, 285(23), 3011-3014 National Public Radio & The Henry J Kaiser Family Foundation (2000) National survey of American adults on technology and national survey of ... studies that test the efficacy of parental education and supervision as well as the adoption of filtering and blocking software under real world conditions Mitchell et al / SEXUAL MATERIAL ON THE ... problematic because some of the installations may have occurred after or as a result of the youth’s exposure So the failure rate may have been considerably lower than 18% (The failure rate was 9% among...
- 29
- 529
- 0
The Impact of ParentalInvolvement Parental Supportand Family Education on PupilAchievements and Adjustment A Literature Review
... was measured by (a) the highest grade attained in any national examination for English, (b) the NCDS mathematics achievement score and (c) the average grade in all public examinations taken Parental ... impact of parental aspirations on the general academic achievement of US adolescents; Ma (2001) who showed a strong impact of parental expectation on achievement in advanced mathematics; Carr and ... entirely consistent with all the available data and each has a common limitation The common limitation is that none of these explanations can account for why many working class parents are fully...
- 110
- 521
- 0
báo cáo hóa học: "Impact of chronic Immune Thrombocytopenic Purpura (ITP) on health-related quality of life: a conceptual model starting with the patient perspective" potx
... monitoring of the ups and downs of their platelet counts The emphasis placed on the fluctuations in this clinical marker appears to cause nearly as much anxiety for the patient as the actual disease ... clinical research Both the US Food and Drug Administration (FDA) and the European Agency for the Evaluation of Medicinal Products (EMEA) have emphasized the value of PRO measures in identifying and ... Oaks, California, USA No other additional funding for this study was provided The decision to submit this manuscript for publication was subject to the approval of Amgen, Inc and all authors Page...
- 14
- 408
- 0
báo cáo hóa học:" The impact of iron overload and its treatment on quality of life: results from a literature review" pptx
... (Dare), and Cochrane Control Trial Register (CCTR) Further, an additional search was done of the Health Economics Evaluation Database (HEED) For HEED, the phrases 'iron chelation', 'thalassaemia', ... emotional functioning [16] The objective of this study was to assess the literature for the impact of iron overload and infusion Iron Chelation Therapy (ICT) on patients' QoL and to assess the availabil- ... clinical trials and patient reported outcomes Jean-François Baladi and Paula Jones work for Novartis Pharmaceuticals Corporation, USA Authors' contributions JFB and PJ conceived the study and all authors...
- 6
- 733
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008