... chemotherapy Patients and methods Patients Patients diagnosed with PTCL between January 2000 and December 2009 from Korean institutions were evaluated for inclusion into the study Patients with a diagnosis ... found that lymphopenia is an unfavorable prognostic factor for patients with PTCL-NOS treated with anthracycline-containing chemotherapy Higher IPI Table Multivariate analysis for overall survival ... prognostic factor for poor OS and PFS in patients with PTCL-NOS treated with anthracycline-containing chemotherapy Lymphopenia was also a useful marker for further stratification of patients at high...
... diabetes A structured dataset was completed on paper forms and returned to the central register; from these data, both patient-specific and aggregated information were provided annually to patients ... may have been that the automated prompts to patients and clinicians regarding the need for a review consultation resulted in increased concordance in interactions between patients and clinicians ... group This is what was found in the trial Thus, the results of the current study support the principle that attitudinally-driven intentions are better translated into action than are normatively-driven...
... importantto recognize a good fat and a bad one The biggest public enemies in the fat world, according to Dr Sears and most scientists today, are saturated fats and trans fats Why are they so bad? ... The next morning, eat that same bagel slathered with a tablespoon or two of peanut butter You ll see that this extra protein will keep you full for at least an additional two hours Tryto eat ... stored fat, promoting weight gain Unfortunately, many fast-food menu items contain massive amounts of saturated fat and trans fat These fats not only pack twice the amount of calories as protein...
... endless, and available in art and craft shops, stationery shops and specialist stores Remember before buying in quantity to test them tomake sure that they will stick to the surface you require, and ... supplies, but it is importantto research the market thoroughly Many manufacturers demonstrations at large stores and it is a good idea to attend these to increase your knowledge When you find out which ... Ifyouhavea talent for painting, photography, calligraphy and writing then you may want touse it in the business; ifyoudont want tomake and sell the cards yourself then consider setting...
... contact is with the manuscript and not with the audience To maintain eye contact with the audience and read text effectively takes a lot of practice Youhaveto take in several lines at a time and ... refer to during your presentation Also, ifyou are using an overhead projector and it breaks or the bulb burns out and youdon'thavea replacement or time to change to bulb, you can refer to your ... numbers are the easiest target words to say slowly and with emphasis You want to emphasize each syllable of any number word For example, ifyouhave the word "fifty" in your speech, and it appears...
... 5¢-ACATATGGTTTCTTCATGCTCTG-3¢ and 5¢- ACAAAGCTTATTTGTAAGGTTTGTTACA-3¢; and for CD69NS84, 5¢-ACATATGTCATGCTCTGAGGACTGG GTT-3¢ and 5¢- ACAAAGCTTATTTGTAAGGTTTGTT ACA-3¢ PCR products were directly cloned into pBSK+ cloning ... amplification enzyme, pCDA401 as a template and the following primer pairs: for CD69NG70, 5¢-ACATATGGGCCAATACACATTC-3¢ and 5¢-ACAAAGCTTATTTGTAAGGTTTGTTACA-3¢; for CD69NV82, 5¢-ACATATGGTTTCTTCATGCTCTG-3¢ ... 5¢-ACAAAGCTTATTTGTAAGGTTTGTT ACA-3¢, and the PCR product was cloned into pBSK+ vector using the SmaI restriction site, and then into pRSETB vector using XhoI and HindIII restriction endonucleases...
... counting attacks are both easier to mount and harder to detect and compensate for: easier to mount because it is easier to obtain access to the DREs than the optical scanners; harder to detect and compensate ... be malicious Because software cannot be trusted to handle malicious data safely, any contact that the EMS machines have with suspect data is a potential vector for compromise This paper focuses ... means that an outsider would need to attack each device individually, thus dramatically increasing the cost of such an attack The primary attack vector on this type of system is to attack the paper...
... Changes Hands When you go to the store to buy groceries, at what pointyou say that a transaction has been made? a When you pick out the produce and canned goods you want and place them into your ... financial accounting standards are often more rigid than managerial accounting standards For instance, financial accounting statements must be audited And they must conform with generally accepted ... Liability? A liability is an obligation that your company will eventually haveto meet For instance, when your company takes out a loan, it is obligated to pay that money back with interest That's a...
... preparation software, practice exams, and test-taking tips and strategies for the PSAT, SAT, and AP exams www.learnatest.com—Provides practice exams for the ACT, ASVAB, AP, and SAT exams, and many more ... regular basis • Dont take stimulants Although sodas are a staple of teen life, and it may be tempting touse chocolate and soda to give yourself that extra boost of energy, these stimulants are only ... Practice taking tests Ifyouhave taken practice tests, either those that youhave created on your own or those that your study buddy has created for you, you will have gotten over the test jitters...
... propose a new way tomake SVR have the similar mathematical form as that of support vector classification, and derive a generalization of SMO to handle regression problems An Improved Way toMake Large-Scale ... for these multipliers, and updates the SVM to reflect the new optimal values The advantage of SMO lies in the fact that solving for two Lagrange multipliers can be done analytically Thus, an entire ... set size, and the number of support vectors for different training algorithms In each data set, the objective values of training error are the same Here we can see that with data set increase, the...
... embed too many photos in your database If possible not embed any at all They will bloat your table and database The best way to show images on your forms are to provide a link to them Store them ... information and useful hints and tips on how to create an Access Database Experience a fresh approach to learning with the aid of a valuable reference manual and a video tutorial that talks toyou ... store it’s data It is a good idea to also sketch out how you want to present the data Do you want to see a view of how many sales you got in August? Do you want to know the total value of sales or...
... close your account until the dispute gets resolved or the case is settled in court If it reaches that pointyou' ll haveto get an attorney It's also importantto note that defective merchandise to ... decision Your credit record will be tarnished for up to ten years and you may find it difficult later on to get a mortgage or credit You may want to talk with a credit counselor oran attorney beforehand, ... cannot threaten legal action against youor report you as delinquent toa creditreporting agency And while your creditor can report that you are disputing your bill, you can take comfort in the...
... yourself that you know you can complete Start simple and always be realistic about what you can and cannot achieve That means, ifyou plan on starting a membership site for stock photography, you ... living your life to its fullest extent It doesn t matter what goals you have, ifyou want tobe more confident, ifyou want to learn to think positively to help manifest good things in your life, if ... excited about anything The best part about healthy living is that it’s easy Youdont need to start eating bean sprouts three meals a day and running three miles before bed to feel good and have...
... causes, purposes, and natural ways of being In ancient Greece, Plato and Aristotle saw the world teleologically—rain falls because water wants tobe lower than air; animals (and slaves) are naturally ... cognitive toolkit, the required scientific concept has tobe applicable to all humans It needs tomakea difference to us as a species, or, more to the point I am going to make, as a key factor ... inheritance and the nature of biology meant that when your parents had a baby, it was anatomically human and mostly fully functional physiologically, but the unique combination of traits that make...
... doubtful validity, especially in naïve participants Adding to that the fact that both responses were re-coded in a way that distorts their original meaning limits any conclusions that can be drawn ... nicotine withdrawal (the last items in the HONC) The authors of the HONC were aware that many of the “symptoms” in this list may be unrelated to smoking, and attempted to resolve this potential confound ... participants’ causal attributions at face value Some even assume that participants can accurately attribute their enjoyment of cigarettes to nicotine: “Several of our subjects seemed to describe a phenomenon...
... pronunciation a few times Step5: Move on to next word and repeat step and Each time the teacher asks the students to say the word for you, nominate another team member by their number The teacher can ... is a team effort The teacher can model the sound again if it is hard and let everyone have another try Step4: Ask a few students to pronounce the word and get the whole class to practise the ... Tip: Try and be very encouraging so this is fun and a challenge and does not make the student feel shy Pick the students to say the word at random, not 1,2,3,4,5,6 It is important that it is...