i of a charged particle in an electromagnetic field
Sensor-based navigation of a mobile robot in an indoor environment
Ngày tải lên :
23/10/2013, 15:15
... beginning of the learning the robot is near a wall in an unknown Vr = min(Va , Cvg Vmin ), where Vmax and Vmin are the maximum and minimum chosen linear speed, respectively An example of implementation ... data base and starting again the planning [15] In fact the main penalization due to unknown obstacles is the decreasing of the linear speed of the robot Conclusion We are interested in the navigation ... Their aim is to incorporate implicitly the imperfection in the information gathering and reasoning process, rather than to determine them explicitly through numerical calculations or mathematical...
- 18
- 431
- 0
báo cáo khoa học: " Thoracoscopic-assisted repair of a bochdalek hernia in an adult: a case report" pptx
Ngày tải lên :
11/08/2014, 02:22
... presenting with acute pancreatitis in an adult J Thorac Cardiovasc Surg 2008, 135:1396-1397 15 Mohammadhosseini B, Shirani S: Incarcerated Bochdalek hernia in an adult J Coll Physicians Surg Pak ... artificial pneumothorax with CO gas insufflation These innovations facilitated the safe return of the herniated organs to the abdominal cavity Secondly, abdominal cavity visualization might be insufficient ... normal In addition, left middle lobe collapse, pneumonic consolidation, pericardial fat pad, pericardial cyst, mediastinal lipoma or an anterior mediastinal mass must be ruled out A chest CT is...
- 5
- 241
- 0
Charged particle in a electromagnetic field 2
Ngày tải lên :
24/05/2014, 19:10
... gauge transformations Problem 14 Lagrangian of Charged Particle in Electromagnetic Field Show that the Lagrangian of a particle with the charge q moving with the velocity v in an electromagnetic field ... eigenfrequencies for an isotropic three-dimensional harmonic oscillator realized as a particle of charge q placed in a uniform magnetic, B, and electric, E, fields which are mutually perpendicular and take ... 16 A particle of the mass m and charge q moves in a constant magnetic field B = (0, 0, B) Show that the orbit of a particle is a helix (30) Solution: Let specify the scalar and vector potentials...
- 8
- 302
- 0
Charged particle in a electromagnetic field 3
Ngày tải lên :
24/05/2014, 19:10
... Bohm-Aharonov Effect Suppose we have electron inside hollow conductor, or “Faraday cage”, with battery which raises potential of cage and region inside, beginning at t = and ending at time t Hamiltonian ... gauge transformations (11) Require that a QM gauge tranformation should take wave fctn ψ and potentials A, φ to physically equivalent set ψ , A , φ Can accomplish this by taking transformation ... use was made of H0ψ0 = i ∂t ψ0 But phase shift in single electron’s h∂ wave fctn can’t a ect observables, since physical quantities bilinear in h ψ and ψ ∗, norm of e−iS/¯ is This result might...
- 12
- 275
- 0
Lagrangian of charged particle in electromagnetic field
Ngày tải lên :
24/05/2014, 19:12
... ∂x ∂x Ta suy hàm Lagrange hạt là: ru r L = T − q ϕ − v .A ( mà ) nên: r2 ur r 1 r2 T = mv L = mv − q ϕ − A. v 2 Trọng hệ t a độ Cartes thì: r & && v = (x; y;z) r u A = (A x ;A y ; A z ) ... không phụ thuộc tường minh vào u r r & x ∂ ( qϕ ) A ϕ; A = 0; =0 & & ∂x ∂x Vậy, ru r dA x d ∂ −q = qϕ − qv .A & dt dt ∂x ( ( ) ) ( ( ) ) - Phương trình Lagrange lo i cho ta: d ∂T ∂T = Qx ... ∂ d ∂ ⇔ − =− qϕ − qv .A + qϕ − qv .A &÷ & dt ∂x ∂x ∂x dt ∂x ru r ru r d ∂ ∂ ⇔ T − qϕ + qv .A − T − qϕ + qv .A = & dt ∂x ∂x ( ) ( ) ( ( ) ) So sánh v i phương trình Lagrange cho trường suy rộng:...
- 2
- 349
- 1
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf
Ngày tải lên :
22/02/2014, 04:20
... respectively By introducing an Ala residue in the place of Gly it is expected that the conformational flexibility of the main chain can be constrained with a minimum perturbation of the local structure, ... lower primer 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer ... behavior of the G26 1A variant can be interpreted in terms of constraints introduced by the Ala side chain The presence of the additional Gly at position 261 possibly offers increased flexibility...
- 6
- 488
- 0
Management of pulmonary tuberculosis patients in an urban setting in Zambia: a patient’s perspective ppt
Ngày tải lên :
06/03/2014, 04:20
... Mfinanga GS: Perceptions of tuberculosis and treatment seeking behaviour in Ilala and Kinondoni Municipalities in Tanzania Tanzan J Health Res 2008, 10(2):89-94 10 Storla DG, Yimer S, Bjune GA: ... Program, Lusaka, Zambia 5Tuberculosis Research Section, Laboratory of Clinical Infectious Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, ... Zambia UNZA), and Macro International Inc: Zambia Demographic and Health Survey 2007 Calverton, Maryland, USA; CSO and Macro International Inc; 2009 World Health Organization: “TB Country Profile,...
- 8
- 612
- 0
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc
Ngày tải lên :
08/03/2014, 09:20
... obtained by P1 transduction using strain CE1224 as the recipient and strains IQ85 and strain MM152, respectively, as donor strains To obtain strain CE1513, strain MM88 was used as Table Bacterial ... polyclonal PhoE-specific antiserum [31] by SDS/PAGE [32] and visualized by autoradiography In vitro transcription, translation, targeting and cross-linking analysis To generate truncated mRNA, plasmids ... hydrophobic H domain and the C-terminal C domain The a- helix in the H domain is predicted to extend up to the Gly at position )10 in the signal sequence Introduction of an a- helix-stabilizing residue...
- 8
- 546
- 0
The Carbon and Global Warming Potential Impacts of Organic Farming: Does It Have a Significant Role in an Energy Constrained World? pptx
Ngày tải lên :
08/03/2014, 23:20
... Finally, reducing transport offers some additional, if smaller, potential for E and GHG gains (and again data for the Canadian food system is lacking) and a significant body of literature has ... Atlantic Dairy Sustainability Model (ADSM) to Evaluate Effects of Pasture Utilization, Crop Input Levels, and Milk Yields on Sustainability of Dairying in Maritime Canada; M.Sc Thesis; NSAC and ... sequestration 2.1 Field Crops Snyder and Spaner [25] recently conducted a review of the sustainability of organic grain production on the Canadian Prairies, including many of the Canadian studies discussed...
- 41
- 524
- 1
Báo cáo y học: "Double chambered right ventricle with severe calcification of the tricuspid valve in an elderly woman: a case report" ppsx
Ngày tải lên :
10/08/2014, 23:21
... MI and SS analyzed and interpreted our patient data TY analyzed cardiac enhanced multislice CT SI, YM and KS were responsible for manuscript editing and advice on the literature review All authors ... clinical examinations and the collection our patient’s data Authors’ contributions NT contributed to the management of the patient, and was a major contributor in writing the manuscript KM, MI ... effective to reduce systolic stenosis and also cardiac oxygen consumption Conclusion DCRV is a rare cardiac anomaly, and is difficult to diagnose in adults Calcification of the tricuspid valve is also...
- 4
- 332
- 0
Báo cáo y học: "Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against HIV" pps
Ngày tải lên :
11/08/2014, 08:21
... were isolated from each animal at the indicated time points following Lmdd-HIV-gag administration and tested for reactivity HIV-Gag peptides (A) Percentage increase in CD44-b7 populations in response ... the American Foundation for AIDS Research (amfAR) Grant 02882-32-RGV, National Institutes of Health Grant AI054183 to R.M.R, National Institutes of Health Grant AI078779 to F.R.F and National Institutes ... monkeys, indicating limited bacterial invasion into the liver, or complete clearance, by days after boost vaccination Our pilot results warrant the testing of attenuated Lm vectors as part of an orally...
- 7
- 393
- 0
Báo cáo y học: "Congenital cystic adenomatoid malformation of the lung associated with bronchial atresia involving a different lobe in an adult patient: a case reportc" ppt
Ngày tải lên :
11/08/2014, 12:20
... hemoptysis, mycetoma or bronchioloalveolar carcinoma [5] Due to its rarity, it is seldom suspected and adult physicians are not familiar with its clinical and radiological findings Chest radiographs ... cavitary neoplasms or inflammatory masses, bullous diseases, bronchiectases and post-inflammatory pneumatoceles Clinical and histological correlations are essential in establishing a diagnosis ... read and approved the final manuscript Author Details Imaging Section, Department of Radiologic and Histocytopathologic Sciences, University of Bologna, S Orsola Malpighi Hospital, Via Massarenti...
- 3
- 356
- 0
Báo cáo y học: " Profile of subjective quality of life and its correlates in a nation-wide sample of high school students in an Arab setting using the WHOQOL-Bref" pot
Ngày tải lên :
11/08/2014, 15:22
... The Ministry of Education authorized and facilitated the study The following played invaluable roles in data collection: Zaina Al-Zabin, Nahed Kamel, Abdel W Awadalla, and Sumai (and Ministry of ... pediatric population health measure: feasibility, reliability and validity Amb Pediatr 2003, 3:329-341 Ohaeri JU, Awadalla AW, Gado OM: Subjective quality of life in a nationwide sample of Kuwaiti ... were variously important in predicting domains of QOL (Table 4) However, the variables that accounted for at least 5% of variance in any domain were: quality of parental emotional relationship (6.1%...
- 12
- 500
- 0
Báo cáo y học: " Virological pattern of hepatitis B infection in an HIV-positive man with fatal fulminant hepatitis B: a case report" doc
Ngày tải lên :
11/08/2014, 17:21
... liver transplantation or prevent a fatal outcome Carman WF, Fagan EA, Hadziyannis S, Karayiannis P, Tassopoulos NC, Williams R, Thomas HC: Association of a pre-core genomic variant of hepatitis ... amino acids; ALT: alanine aminotransferase; AP: alkaline phosphatase; AST: aspartate aminotransferase; D: aspartic acid; DL-DNA: duplex linear DNA; DR-1: direct repeat 1; DR-2: direct repeat ... investigated the hepatic and extrahepatic patterns of HBV infection in a patient who was also infected with HIV and who was participating in a prospective study of acute hepatitis B, which fatally...
- 7
- 348
- 0
Báo cáo y học: "Peripheral primitive neuroectodermal tumor of the urinary bladder in an Arab woman with history of squamous cell carcinoma: a case report" doc
Ngày tải lên :
11/08/2014, 17:21
... 67-year-old diabetic and hypertensive Arab woman in February 2006, due to severe hematuria and fever In January 2005, the woman had already been treated in a hospital of Great Britain for repeated ... hematuria for the duration of one year During this initial admission, cystoscopy revealed an intrinsic urinary bladder mass that was resected Histologically, it was reported as poorly differentiated ... chromogranin and leucocyte common antigen (CD3 und CD20) were not significant markers in this case, in accordance with the results of Desai and Banerjee et al [8,9] Patients in some cases already had...
- 4
- 306
- 0
Báo cáo y học: "Development and management of systemic lupus erythematosus in an HIV-infected man with hepatitis C and B co-infection following interferon therapy: a case report" doc
Ngày tải lên :
11/08/2014, 17:21
... Figure Patient’s clinical course A: summary of therapy B: serum creatinine Insert: renal biopsy, haematoxylin and eosin stain (magnification ×200) and C1q immunoperoxidase stain (magnification ... seven years after INF administration Most present with arthralgia and a highly elevated ANA Changes in type I IFN levels and pDC redistribution and activation are important in pathogenesis of SLE ... entecavir The progression of HCV-related liver disease with immunosuppressants remains unclear, and his viral load remains high In view of his known liver disease and anaemia, we avoided azathioprine...
- 5
- 624
- 0
Báo cáo y học: "Amoebic liver abscess – a cause of acute respiratory distress in an infant: a case report" potx
Ngày tải lên :
11/08/2014, 19:21
... epidemiologic investigations of their families Pediatrics 1980, 65:799-803 Harrison HR, Crowe CP, Fulginiti VA: Amoebic liver abscess in children: Clinical and epidemiological features Pediatrics ... gastrointestinal tract (GIT) Complications of amebiasis as ALA are the most common manifestations of amebiasis outside the GIT [4,5] It is more common in adults and is associated with more severe morbidity ... Only a small amount of thick membrane like material was obtained and this was sent for analysis and culture Due to his continuing respiratory distress, the infant was taken to surgery where a right...
- 3
- 326
- 1
Báo cáo y học: " Pelvo-ureteric junction obstruction in the lower pole moiety of a duplex kidney with an associated intraparenchymal abscess: a case report" pot
Ngày tải lên :
11/08/2014, 21:22
... an avidly enhancing capsular rim On the MR appearances, the differential diagnosis was either a tumour or an abscess Given that the patient was septic, this cystic lesion with an enhancing capsule ... coronal magnetic resonance imaging scan with fat saturation and gadolinium enhancement The cortical mass is seen as a low signal with an enhancing rim (arrows) Figure (arrow) to shows with obstruction ... T2-weighted (fluid)magneticmass (arrows) with scan showing T2-weighted axial magnetic resonance imaging scan showing a high-signal (fluid) cortical mass (arrows) with an irregular low-signal capsule The...
- 3
- 306
- 0
Báo cáo y học: "Dislocation of the fibular head in an unusual sports injury: a case report" docx
Ngày tải lên :
11/08/2014, 23:21
... Photograph of the knee showing anterolateral dislocation of the proximal tibiofibular joint had a failed manipulation under anaesthesia and the joint needed an open reduction in which the fibular ... variant is rare and as in our case could be a cause of failed closed reduction Conclusion Dislocation of a horizontal type of proximal tibiofibular joint is exceedingly rare Proximal tibiofibular dislocation ... of the knee showing dislocated fibuAnterior-posterior view of the knee showing dislocated fibular head The mechanism of the anterolateral dislocation is inversion and plantar flexion of the ankle...
- 3
- 365
- 0