i do not own a radio station i do not own stock in any radio group i simply use radio as large word of mouth for my clients
Ideavirus, một cấp độ khác với word of mouth marketing
... (word- of- mouth) , ideavirus có tính chất mà word- of- mouth marketing Trong gần tác động nhiều i u khiển trình word- of- mouth marketing, ngư i ta tạo ideavirus để tăng khả thành công lan truyền i u khiển thông ... cho Ngo i ra, word- of- mouth từ sinh tr i qua chu trình sinh - phát triển - suy tho i - chết Word- of- mouth chết mà thứ trở nên hiển nhiên không lây lan qua truyền miệng n a, ngược l i ideavirus thành ... ví dụ hai ngư i có tên Paul Revere William Dawes Khi giai đoạn chiến tranh, hai thông báo cho bên biết quân Anh t i Trong Revere ngư i tin tưởng chẳng thèm nghe l i Dawes T i vậy? T i Revere...
- 8
- 235
- 0
Lan truyền Ideavirus, một cấp độ khác với word of mouth marketing - Phần 2 docx
... marketing truyền miệng (word- of- mouth) , hiệu ứng ideavirus có tính chất mà word- of- mouth marketing Trong gần tác động nhiều i u khiển trình word- of- mouth marketing, ngư i ta tạo lan truyền Ideavirus ... hãnh diện có đem lây lan cho ngư i khác Một sản phẩm ideavirus thân tự khẳng định quảng cáo cho Ngo i ra, word- of- mouth từ sinh tr i qua chu trình sinh - phát triển - suy tho i - chết Word- of- mouth ... lây lan (Smoothness): • Bất ngư i thiết kế lan truyền Ideavirus đặt mục tiêu tiếp xúc v i virus bị nhiễm Nhiễm th i i m gặp m i iPhone Steve Jobs lan truyền Ideavirus g Tính bền bỉ: • Lan truyền...
- 6
- 385
- 0
Lan truyền Ideavirus, một cấp độ khác với word of mouth marketing - Phần 1 ppt
... nghìn ngư i khác Trong ví dụ mình, Gladwell nêu ví dụ hai ngư i có tên Paul Revere William Dawes Khi giai đoạn chiến tranh, hai thông báo cho bên biết quân Anh t i Trong Revere ngư i tin tưởng ... tán virus gi i nhiều so v i ngư i khác Họ ngư i hắt xì Trong sách The tipping point mình, Malcolm Gladwell g i quy luật số (The law of the few) chia ngư i làm ba nhóm: Connector, Mavens Salespeople ... hiểu phương thức đó, cần ph i biết đặc tính lan truyền Ideavirus gì? Lan truyền Ideavirus - Cần có kẻ “hắt xì h i • Một ideavirus, không giống virus bình thường khác, có tr i tim Một tr i tim...
- 4
- 295
- 0
Lab Linux phan I, II Installing Linux as a Server
... -q -a -d -i -c Ý ngh a (packagefile) hiển thị package (all) truy vấn tất package c i đặt (documentation) liệt kê files t i liệu liên quan đến package (information) liệt kê thông tin package name, ... 0989012418 www.athena.edu.vn B i Lab 2: Package Management - Redhat Package Manager (RPM) công cụ dùng để Installing, Uninstalling Upgrading software cho hệ thống Linux - Một RPM package file ch a chương ... partition m i, linux bắt buộc t i thiểu ph i tạo partition sau: + Partition ch a thư mục gốc (/) hạt nhân (kernel), partition g i Linux Native Partition + Partition Swap dùng làm không gian hoán...
- 99
- 1,023
- 6
Báo cáo khoa học: A functional polymorphism at the transcriptional initiation site in b2-glycoprotein I (apolipoprotein H) associated with reduced gene expression and lower plasma levels of b2-glycoprotein I docx
... apolipoprotein H, is a plasma glycoprotein that has been implicated in a variety of physiological pathways, including blood coagulation, thrombosis, and the production of autoantibodies (APA) b2GPI plasma ... indicating that these two sites are in linkage equilibrium, as also reflected in the pair-wise measure of linkage disequilibrium (Table 2) Impact of the -1C A mutation on b2GPI plasma levels Table ... plasma variation is under genetic control and that genetic variation in b2GPI is a major determinant of this variation In our attempt to determine the molecular basis of b2GPI plasma variation, we...
- 9
- 462
- 0
Function of Soils for Hum a n Societies and the Environment .The G e o l o g i c a l Society of L ppt
... ecological risk assessment 63 BA~UELOS, G S & LIN, Z.-O Reuse of agricultural drainage water in central California: phytosustainability in soil with high levels of salinity and toxic trace elements ... Society's international journals and books, and acts as European distributor for selected publications of the American Association of Petroleum Geologists (AAPG), the Indonesian Petroleum Association ... provides a balanced coverage of the subject Being accepted for presentation at the meeting does not guarantee inclusion in the book More information about submitting a proposal and producing a...
- 5
- 287
- 0
Báo cáo y học: "Type I interferon receptor controls B-cell expression of nucleic acid-sensing Toll-like receptors and autoantibody production in a murine model of lupus" doc
... therapy based on the targeting of subsets of nucleic acidassociated autoantigens These studies are of particular importance given that IFN -I and TLR inhibitors are already being tested in SLE in ... directed against the significant antigens identified by SAM The results are displayed as a heatmap (Figure 2) SAM identified reactivity to components of two RNA-containing complexes as significantly ... Additional files The following Additional files are available online: Additional data file A table providing a description of the autoantigens used on the protein microarrays, which includes the...
- 10
- 408
- 0
Báo cáo sinh học: " Expected efficiency of selection for growth in a French beef cattle breeding scheme. I. Multistage selection of bulls used in artificial insemination" docx
... the fact that uncertainty was only considered for preweaning parameters Sampling standard deviations of differentials for Hs are in the range of uncertainty in maternal variance of W210 Standard ... economic margin per additional kilogram of final weight was higher than before weaning, because cheaper feed sources, such as maize silage, are used A II presents a full pendix P description of ... Prédiction de l’efficacité d’un schéma de sélection français sur la croissance en race bovine allaitante I Sélection par étapes des taureaux destinés l’insémination artificielle En races bovines...
- 22
- 373
- 0
Báo cáo khoa học: "Increased susceptibility of Huh7 cells to HCV replication does not require mutations in RIG-I" doc
... HCV infection independently of RIG -I, and triggers an antiviral state [14] Class III Phosphatidylinositol 4Kinase alpha and beta were recently identified as regulators of hepatitis C virus replication ... oligo AACTAAAGGCGCGCCATGGATAGATCCGGAAAGCCTGAACTCAC (carrying the Asc1 restriction site) and anti-sense oligo AGTTATGGTTTAAACCTATTCC TTTGCCCTCGGACGAGTGCTGGG or anti-sense oligo AGTTATGGTTTAAACCTATTCCTTTGC ... Ohbayashi A, Harada H, Katayama T, Kikuchi S, et al: Hepatitis-C Virus-Infection Is Associated with the Development of Hepatocellular-Carcinoma Proceedings of the National Academy of Sciences of the...
- 8
- 315
- 0
A study on the problem face by students in reading English for business at University of Economics and Business administration-Thai Nguyen University and some i
... reading strategies during the three-phase procedure in reading class including pre-reading phase, while-reading phase and post-reading phase Each phase has different goals and thus requires various ... the participants may discover a common understanding of the issues as they share the meanings behind their ideas As the sharing takes place, new ideas may arise by the association Those ideas are ... any specialized language of any particular field of human activity In addition to this, the use of authentic text, economic magazines, business documents and other specialized teaching materials...
- 67
- 1,208
- 2
List the components of a radio system
... signal exactly Amplifiers (continued) Antennas • Transmit or receive an RF signal Multiple Access • Only a limited number of frequencies are available for radio transmission – Conserving the use ... direction – Rarely used in wireless communication today • Except for broadcast radio and television • Half-duplex transmission – Sends data in both directions • But only one way at a time – Used ... Mixers (continued) Amplifiers • Increase the amplitude of an RF signal • RF signals tend to lose intensity (amplitude) – When they move through circuits, air, or space • Amplifier is an active...
- 30
- 920
- 0
Tài liệu Speedwealth - How to make a milion in your own business in 3 years or less doc
... marketplace already has of your product or service, and how readily available it is elsewhere Why does a brain surgeon earn as much in one day as a gas station attendant earns in a whole year? ... business, and you personally have to perform the service, such as giving massages, there is a definite ceiling on your income Let’s face it, there are only so many massages a masseuse can give in a day! ... Getting rich quickly is feasible Getting rich quickly is feasible for you There’s a lot of skepticism about “making money fast,” but I think “Get Rich Quick” has gotten a bad rap! In the past, society...
- 102
- 646
- 0
Tài liệu Báo cáo khoa học: The localization of FGFR3 mutations causing thanatophoric dysplasia type I differentially affects phosphorylation, processing and ubiquitylation of the receptor pptx
... that propagate FGFR signals via different signalling pathways resulting in the regulation of many cellular processes including proliferation, differentiation, migration and survival [1–4] Dominant ... kDa mannose-rich isoform into an endo H-resistant intermediate form (Fig 3A, left) This was in keeping with previous reports that BFA treatment induces Golgi enzymes (mannosidase II and thiamine ... monoubiquitylation has been recently identified as the main mechanism regulating RTK endocytosis and degradation [27,28] and is associated in yeast with proteasome-independent functions including...
- 16
- 573
- 0
Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt
... promoter activity in the 5¢-upstream region of DNASE1 exon 1a Results Mapping of transcription initiation sites in the human DNASE1 gene To identify the transcription initiation sites of DNASE1 in pancreas, ... molecular basis for our observations is essential to evaluate the elevated DNase I activity in the sera of patients with AMI and to validate the use of serum DNase I activity as a new diagnostic marker ... Hoshizaki H, Oshima S et al (2004) Diagnostic use of serum deoxyribonuclease I activity as a novel early-phase marker in acute myocardial infarction Circulation 109, 2398–2400 14 Arakawa K, Kawai...
- 12
- 609
- 0
Báo cáo khoa học: Deoxyribonuclease I footprinting reveals different DNA binding modes of bifunctional platinum complexes potx
... adduct and at several base pairs containing the base on the 5’ side of the adduct The base pairing is even lost in the base pairs containing 5¢-platinated guanine and the base between platinated ... 1,5-IAC containing single, site specific 1,5-intrastrand CL of BBR3464 See Fig for other details Cisplatin can form minor 1,3-intrastrand CLs in DNA and it is interesting to compare the results of ... footprinting has been already used to characterize the DNA binding of a number of small molecules of biological significance [1,6–15], including antitumor cis-diamminedichloroplatinum(II) (cisplatin) (Fig...
- 12
- 208
- 0
Speedwealth: How to Make a Million in Your Own Business in 3 Years or Less docx
... to anyone you feel might be able to use the information in it to help them toward their own financial independence The conditions for it's redistribution are as follows: 1) You may not sell this ... Conditional Redistribution Rights Welcome to the best selling book, SpeedWealth™, from internationally renowned author and speaker, T Harv Eker You are encouraged to read and forward this book ... follows: 1) You may not sell this book either digitally or in any printed hard copy format 2) You must forward this book completely intact with all 102 PDF pages included ...
- 104
- 494
- 1
Báo cáo Y học: The group I-like ribozyme DiGIR1 mediates alternative processing of pre-rRNA transcripts in Didymium iridis pptx
... manufacturer’s instruction Plasmids harbouring the ITS1 insert in the correct orientation were linearized by HindIII digestion, while the ITS2 insert was further subcloned into the XbaI/HindIII ... excised intron [7] Thirdly, the 7.5-kb RNA contains a polyadenylation signal, which in mRNA formation induces cleavage and polyadenylation of the I- DirI mRNA Finally, a spliceosomal intron (I5 1) ... and the part of the SSU rRNA that is located downstream of Dir.S956-1 All intron sequences downstream of IPS2, including the spliceosomal intron within the I- DirI protein coding region, are also...
- 9
- 432
- 0
I cannot prevent him from smoking because of his stubbornness pptx
... ta, đ i từ tân ngữ giữ vai trò làm tân ngữ câu “from”- từ, gi i từ “smoking”- động từ chia dạng V-ing có động từ gốc “smoke” – hút - “because of – vì, “because” – vì; liên từ lí Sau “because of ... -"cannot"= “can’t" = "be not able to” – không thể, khả năng; dạng phủ định động từ khuyết thiếu “can” – “can’t” theo sau động từ nguyên mẫu "to" (infinitive without to) - “prevent him from smoking” ... *I cannot prevent him from smoking because of his stubbornness Hình thức cấu trúc ngữ pháp: “prevent somebody/someone from doing something” – ngăn/ cản trở làm việc Chúng ta quan sát câu sau...
- 5
- 327
- 0
I met David by chance while I was waiting for my nephew pptx
... khi, khi, lúc I was waiting for – chờ Thì khứ tiếp diễn, dùng để diễn tả hành động xảy th i i m xác định khứ, có cấu trúc là: “S + was/ were + V-ing” Trong "I, he, she, it, Danh từ số + was" ... Các bạn di chuột vào cụm từ để biết chức cụm câu: I met David by chance while I was waiting for my nephew 3 T i câu l i dịch vậy? - Mệnh đề ch a “while” đứng đầu câu v i cấu trúc sau: “While + ... khứ Chúng ta quan sát câu sau Các bạn di chuột vào từ để biết thể lo i từ từ câu: (Các bạn kích chuột lần vào từ để biết thêm chi tiết từ đó) I met David by chance while was waiting for my nephew...
- 6
- 531
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008