0

hypertension with proportions aware treated and controlled among a national sample survey of 9832 vietnamese adults aged 25 years and over with extrapolations to the general population in 2009 51 44 million aged 25 years and o

Báo cáo y học:

Báo cáo y học: " Physiotherapy-supervised mobilization and exercise following cardiac surgery: a national questionnaire survey in Sweden" pot

Báo cáo khoa học

... mobilized their patients with regard to sitting and standing on postoperative day Invasive cardiovascular monitoring is common in the early postoperative period and affects the ability to walk ... too many patients, lack of resources, shortness of care time, and increased care load The main purpose of physiotherapy following cardiac surgery was seen as preventing and treating postoperative ... the routines in Australia and New Zealand described by Tucker at al [8] The educational content of the preoperative information was similar, with early mobilization, post-sternotomy recovery and...
  • 7
  • 437
  • 0
Báo cáo y học:

Báo cáo y học: " A two-year survey of the oseltamivir-resistant influenza A(H1N1) virus in Yamagata, Japan and the clinical effectiveness of oseltamivir and zanamivir" potx

Báo cáo khoa học

... A/ Yamagata/55 /2009 A/ Yamagata/57 /2009 A/ Yamagata/76 /2009 A/ Yamagata/120/2008 A/ Yamagata/133/2008 A/ Yamagata/26 /2009 A/ Yamagata/126/2008 A/ Yamagata/77 /2009 A/ Yamagata/20 /2009 A/ Yamagata/10 /2009 A/ Yamagata /51 /2009 ... A/ Yamagata/77 /2009 A/ Yamagata/36 /2009 A/ Yamagata/29 /2009 A/ Yamagata /51 /2009 A/ Yamagata/20 /2009 A/ Yamagata/133/2008 97 A/ Yamagata/ 125/ 2008 A/ Yamagata/126/2008 A/ Yamagata/53 /2009 A/ Yamagata/26 /2009 ... A/ Yamagata /51 /2009 95 A/ Yamagata/53 /2009 G18 5A A/Yamagata/128/2008 A/ Yamagata/16 /2009 A/ Yamagata/29 /2009 A/ Yamagata/61 /2009 A/ Yamagata/ 125/ 2008 A/ Yamagata/36 /2009 G185V A/ Yamagata/48 /2009 A1 89T A/ NewJersey/15/2007...
  • 8
  • 382
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A 15-year survey of reproductive efficiency of Standardbred and Finnhorse trotters in Finland descriptive results." pptx

Báo cáo khoa học

... than for the FH The total population of the SB in Finland is about 25 000 making it the largest horse breed in Finland According to the data base of Suomen Hippos, 64% of the SB mares were born ... owned the data and was actively involved in the planning of the research and made comments to the text TK was the initiator and leader of the project and had the major responsibility for writing and ... unfavourable to the FH and can at least partly explain the lower foaling rates of the FH mares Decreasing foaling rates The foaling rates showed a decline over the years, which was particularly...
  • 11
  • 148
  • 0
Báo cáo y học:

Báo cáo y học: "Assessment of balance and risk for falls in a sample of community-dwelling adults aged 65 and older" potx

Báo cáo khoa học

... placed in a popular local senior publication as a means of reaching a greater population base of seniors This publication was circulated to all senior centers and senior health organizations in the ... with little tobacco use, and inclusion of regular exercise, the proportion reporting no limitations on their daily activities was somewhat lower than the national average for people aged 65 and ... assessment of postural stability among physical therapists and occupational therapists Patients are given specific instructions to stand on one leg for as long as possible in one of two conditions, with...
  • 8
  • 372
  • 0
Báo cáo y học:

Báo cáo y học: " The lateral trauma position: What do we know about it and how do we use it? A cross-sectional survey of all " ppsx

Báo cáo khoa học

... described in the EMS protocols, a teaching video was made, and training and retraining was instituted locally PHTLS Norway has adopted LTP in their educational program (Sindre Mellesmo, personal communication) ... practice this may not be fast enough in the back of an ambulance en route to hospital There are controversies about the optimal method of airway management [8,11,12] and the effect of endotracheal ... ruled out There are obviously good arguments for the use of LTP At the same time, minimal changes to the spinal position may be harmful to the trauma patient The aim of this study was to investigate...
  • 5
  • 330
  • 0
a comparative acoustic study of hanoi vietnamese and general american english monophthongs = phân tích âm học so sánh hệ thống nguyên âm đơn tiếng việt hà nội và tiếng anh mỹ phổ thông

a comparative acoustic study of hanoi vietnamese and general american english monophthongs = phân tích âm học so sánh hệ thống nguyên âm đơn tiếng việt hà nội và tiếng anh mỹ phổ thông

Khoa học xã hội

... average values of the formants 21 and the most useful representation of the vowels of a language is a plot showing the average values of formant one and formant two for each vowel as spoken by a ... contours It can be concluded from the examination of the spectrograms of inh, nhi, and nha that [] has two formants of approximately the same values as that of [i] The consonants formants, therefore, ... parts of upper Midwest, including Illinois, Wisconsin, Minnesota, northern Ohio, and northern Indiana In order to increase the homogeneity of the sample, ensuring that they all speak GA, a procedure...
  • 75
  • 453
  • 0
A comparative acoustic study of Hanoi Vietnamese and general American English monophthongs

A comparative acoustic study of Hanoi Vietnamese and general American English monophthongs

Tổng hợp

... highly practical values in teaching the pronunciation of one language to learners of the other language Scope of the research and the research questions The study first examined the quality of the ... physiological fantasy to express the idea Acoustics offers sufficient tools for explaining the vowel qualities The production of a speech sound involves firstly the vibration of the vocal cords, ... method, while having the advantage of being straightforward, has put forwards ideas which remain an approximation to the truth Ladefoged and Johnson (2011, p.197) comment, Traditional articulatory...
  • 3
  • 290
  • 1
báo cáo hóa học:

báo cáo hóa học: " Additional impact of concomitant hypertension and osteoarthritis on quality of life among patients with type 2 diabetes in primary care in Germany – a cross-sectional survey" doc

Hóa học - Dầu khí

... sample of patients with type diabetes with data of the general population extracted out of the German National Health Interview and Examination Survey [16] Therefore, according to normative data we ... total sample of patients with type diabetes in comparison to normative data All data for each of the eight SF-36 subscales were not normally distributed Compared to the general population QoL was ... a major risk factor for cardiovascular mortality and morbidity especially for patients with type diabetes [32] This has to be taken into account as an additional and important risk factor, both...
  • 7
  • 458
  • 0
Báo cáo y học:

Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

Y học thưởng thức

... interlaced polymerase chain reaction Med Sci Monit 2001; 7: 345-9 14 Ogawa Y, Itoh H, Nakagawa O, et al Characterization of the 5'-flanking region and chromosomal assignment of the human brain ... sequences may function as transcriptional or translational regulators, and that they may modify the function of a protein when the tandemly repeated region lies within the coding region of the gene ... Tokyo, Japan) The electrophoresis parameters were set according to the manufacturer’s protocol Sequencing analysis Two oligonucleotides (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to...
  • 7
  • 612
  • 1
báo cáo hóa học:

báo cáo hóa học:" Health-related quality of life and physical well-being among a 63-year-old cohort of women with androgenetic alopecia; a Finnish population-based study" pot

Hóa học - Dầu khí

... health and the participant's own opinion of his or her overall physical fitness and life satisfaction were also asked (good, moderate or poor) A sum score of overall physical capacity was constructed ... population Table gives the percentages and Table gives the means of the background characteristics of the women stratified into the categories of normal hair (grade and I on Ludwig's scale) and ... except emotional well-being tended to be lower This is the first study of an unselected and representative population of women to report an association of AGA with the general measures of HRQOL, which...
  • 7
  • 354
  • 0
Báo cáo y học:

Báo cáo y học: "HLA class II DR and DQ genotypes and haplotypes associated with rheumatic fever among a clinically homogeneous patient" pptx

Báo cáo khoa học

... contributions to the conception and design of the study, acquisition of data, and performed analysis and interpretation of data ShR performed data acquisition GD made contributions to the conception and ... from the Databank of the Immunology Institute of Latvia The above individuals were free of autoimmune disease and had no family history of RF In both groups (RF patients and healthy individuals) ... in the heart In acute RF, Aschoff bodies (conglomerates of monocytes/macrophages and neutrophils) are frequently found in the heart and play an important role in the triggering of local inflammatory...
  • 9
  • 327
  • 0
báo cáo khoa học:

báo cáo khoa học: "A solid pseudopapillary tumor of the pancreas treated with laparoscopic distal pancreatectomy and splenectomy: a case report and review of the literature" ppt

Báo cáo khoa học

... provide a lymphadenectomy comparable to that of open distal pancreatectomy, a fact that may limit the applicability of laparoscopic surgery to the treatment of pancreatic adenocarcinoma The issue of ... in 27.5% of all cases In our case, the histopathologic examination finally revealed a cystic-solid pseudopapillary neoplasm of the pancreas This rare neoplasm accounts for 1% to 2% of all exocrine ... pancreatic body and tail, providing a morbidity rate comparable to that of the open procedure and a substantially shorter length of stay However, laparoscopic distal pancreatectomy fails to provide...
  • 4
  • 236
  • 0
báo cáo khoa học:

báo cáo khoa học: " Nickel and low CO2-controlled motility in Chlamydomonas through complementation of a paralyzed flagella mutant with chemically regulated promoters" ppsx

Báo cáo khoa học

... form of the RSP3 gene [15] No data are available, to our knowledge, on the capacity of the CAH1 and CYC6 inducible promoters to drive complementation of Chlamydomonas mutants To assess the capacity ... encounter in the case of the CYC6 and CAH1 promoters, probably due to the smaller number of colonies screened in our study and to the fact that the vast majority of the insertions, in our case, ... was used as an internal standard for normalization The oligonucleotides used to amplify the RSP3-HA transgene are: RSP3HA forward: TACGCCTAAAGATCTGAATTCGG; RSP3HA reverse: TCAGCGAAATCGGCCATC These...
  • 8
  • 301
  • 0
Báo cáo y học:

Báo cáo y học: " Effects of inhaled iloprost on right ventricular contractility, right ventriculo-vascular coupling and ventricular interdependence: a randomized placebo-controlled trial in an experimental model of acute pulmonary hypertension" ppt

Báo cáo khoa học

... further pharmacodynamic and pharmacokinetic studies are warranted to define the optimal dosage and strategies to prolong the duration of action for inhaled iloprost in the perioperative setting Page ... findings with systemic application of PGI2 [8] – was associated with an improvement in global haemodynamics and a restoration of LV preload The reduction of RV afterload was associated with a paradoxical ... piritramide (1 mg/kg) and atropine (0.5 mg), anaesthesia was induced with intravenous sodium pentobarbital (12 mg/kg) After endotracheal intubation, anaesthesia was maintained with a continuous intravenous...
  • 13
  • 231
  • 0
SPECIAL REPORT: National Survey of Children’s Health Finds Intact Family and Religious Participation Are Associated with Fewer Developmental Problems in School-Age Children pdf

SPECIAL REPORT: National Survey of Children’s Health Finds Intact Family and Religious Participation Are Associated with Fewer Developmental Problems in School-Age Children pdf

Sức khỏe trẻ em

... Longitudinal Survey of Youth (NLSY) for the National Institute of Child Health and Human Development; and the National Survey of Children for the Foundation for Child Development and the National Institute ... (ECLS-B), the Early Childhood Longitudinal Study of a Kindergarten Cohort (ECLS-K), and the school readiness component of the National Household Education Survey for the National Center for Education ... analysis of the survey data, the lack of an intact two-parent family and of regular religious training continue to be linked with developmental problems among children and adolescents The strength of...
  • 36
  • 343
  • 0
Báo cáo khoa học: Molecular basis for substrate recognition and drug ˚ resistance from 1.1 to 1.6 A resolution crystal structures of HIV-1 protease mutants with substrate analogs pptx

Báo cáo khoa học: Molecular basis for substrate recognition and drug ˚ resistance from 1.1 to 1.6 A resolution crystal structures of HIV-1 protease mutants with substrate analogs pptx

Báo cáo khoa học

... Advanced Photon Source, Argonne National Laboratory, and at the beamline X26C of the National Synchrotron Light Source at Brookhaven National Laboratory, for assistance during X-ray data collection Use ... and partially by the small (0.3 A) shift of the CA atom of Ala82 ⁄ 82¢ P1¢-Nle showed three conformations for the side chain and had closer contacts with the CB atom of Ala82 in PRV8 2A than observed ... for Val in the ˚ PR The CE atom of P3¢ Arg moved  1.2 A and formed closer interactions with the CB atom of Ala82 All of these observed structural changes and closer van der Waals interactions...
  • 13
  • 302
  • 0
báo cáo hóa học:

báo cáo hóa học:" Mycophenolate pharmacokinetics and pharmacodynamics in belatacept treated renal allograft recipients – a pilot study" doc

Hóa học - Dầu khí

... http://www.translational-medicine.com/content/7/1/64 chemical and haematological parameters were performed according to standard methods at the clinical laboratory To evaluate the variability of IMPDH activity and ... protocol was also approved by the Norwegian Medicines Agency Written informed consent was obtained from all participants Samples Samples were collected on one occasion before transplantation and ... investigations involved determination of IMPDH activity, analyses of IMPDH and expression and characterization of T cell subpopulations The PK and PD profiles of MPA changed with time after transplantation...
  • 14
  • 532
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Updated survivals and prognostic factor analysis in myeloma treated by a staged approach use of bortezomib/thalidomide/dexamethasone in transplant eligible patients" pot

Hóa học - Dầu khí

... patients had complete change of paraprotein (one from IgA/kappa to IgG kappa, and one from IgD/lambda to IgG/kappa) Statistical analysis OS was defined as time from commencement of induction therapy ... instead of VAD Finally, DAPK methylation and oligoclonal reconstitution as potential adverse and favorable risk factors in myeloma warrants further validation with larger number of patients in prospective ... responsible for the conception, design, and acquisition of data, analysis and interpretation of data, writing and approval of the manuscript Competing interests The author declares that they have...
  • 7
  • 489
  • 0
báo cáo hóa học:

báo cáo hóa học: "Use of medications by people with chronic fatigue syndrome and healthy persons: a population-based study of fatiguing illness in Georgia" pptx

Hóa học - Dầu khí

... exclusionary for CFS [9,10], the clinical evaluation included a standardized past medical history, a review of systems, a standardized physical examination, and routine laboratory testing of blood and ... frequency of use of NSAIDs (aspirin excluded) among controls in our study appears comparable to the 32% estimated prevalence of joint pain in the general population of Georgia, or 33% for the USA [17], ... compared to the ISF (3%) or the Well group (0%) but also when compared to the national average of 1% [26] In the national survey, half of the users of muscle relaxants took them for more than...
  • 11
  • 512
  • 0
báo cáo hóa học:

báo cáo hóa học: " Associations between general self-efficacy and health-related quality of life among 12-13-year-old school children: a cross-sectional survey" potx

Hóa học - Dầu khí

... interpretation of data and revision of the manuscript All authors read and approved the final manuscript Additional material Additional file Health-Related Quality of Life (HRQOL) according to sociodemographic ... purpose of the study was to obtain knowledge about general quality of life among children and adolescents They were also informed that their responses would Page of (page number not for citation ... association between GSE and HRQOL in a sample of Norwegian school children, and explore how this association is related to sociodemographic characteristics Based on both empirical research and theory,...
  • 8
  • 435
  • 0

Xem thêm