however changes resulting from events after the acquisition date such as reaching a specified share price or achieving a milestone on a research and development project are not measurement period adjustments
Báo cáo y học: "Global expression changes resulting from loss of telomeric DNA in fission yeast" pps
... 5'-CTTCAAAAACTGCTAGAGATATCGCCGG-3' and 5'-GTACTGGTAGTCCTCTGATGTATGGG-3' P3': 5'-ATGCCCCGTACGCTTATCTA-3' and 5'-TTTGCCTTTCTAGCCCATGA-3' Pdh: 5'-CAACACCAATACTGACGATGATG-3' and 5'-GCAATAGAACCAGCGGTTTG-3' Primers for centromeric ... using the Pearson correlation around zero (termed the Standard correlation in GeneSpring) with a minimum distance of 0.001 and a separation ratio of Gene annotations were taken from GeneDB at the ... responses may be due to a fission yeast telomere structure that was not as strongly recognized as aberrant, perhaps mitigating a DNA-damage response It is also possible that had budding yeast survivors...
- 15
- 259
- 0
báo cáo khoa học: " Social networks, work and network-based resources for the management of long-term conditions: a framework and study protocol for developing self-care support" potx
... sociodemographic background, medical conditions and health status, use of self-care and self-care support, and a set of validated measures on aspects of social capital and social support A second survey ... [20,21] (one on information-based interventions and the other on social networks) The evidence from our review of informationbased interventions indicates that informational strategies that adopt a ... implementation into practice [5], forms the basis of the Collaboration for Leadership in Applied Health Research and Care for Greater Manchester (CLAHRC) The focus of the research agenda described...
- 7
- 331
- 0
báo cáo khoa học:" Cephalometric norms for the Saudi children living in the western region of Saudi Arabia: a research report" potx
... (Table and figure 1) The mean value, standard deviation and range of each variable was calculated and compared with the norms established for Saudi adults living in the western region of Saudi Arabia ... male and female groups To assess tracing errors, a second tracing was prepared for every 10 tracings The mean error in linear measurements was ± 0.35 mm The mean error in angular measurements was ... SNA SNB ANB NA-APog Intersection between NPog plane and Frankfort horizontal plane Intersection between NPog plane and Frankfort plane Maxillary apical base relationship to anterior cranial base...
- 6
- 377
- 0
Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc
... ACGTTGGATGAATCCCCGCAGACCATGACAC fwd ACGTTGGATGAGTCGGTAGCAACACCAGG rev ACGTTGGATGACCATGACACCTTCCTGCTG fwd ACGTTGGATGGGAGTGAAAAGATGTGCTGG rev ACGTTGGATGCCACTTCCTCTGCACAAATC fwd ACGTTGGATGAGAGAACTGGGTTAAGGCAG ... Primer Callrate (%) fwd ACGTTGGATGAAAATACTGGGACTCGAGGC rev ACGTTGGATGTGCTGTATCTATAGCCCTCC fwd ACGTTGGATGGGGCACCAATTAACTAAGGC rev ACGTTGGATGTGAGGGCATGGAAGGTTCAG fwd ACGTTGGATGAGTCGGTAGCAACACCAGGC ... using the same ISAAC core questions at age 10, all analyses of association with asthma in the MAS population were also performed at this and no other age As BHR values were only available at age...
- 12
- 355
- 0
Báo cáo y học: " The NICE ADHD health technology assessment: A review and critique" doc
... compared to short-acting formulations [56-60] Although analyses based on administrative data typically not allow differential analysis of reasons for treatment discontinuation and may be distorted ... concerning data selection and synthesis as well as the model developed for economic evaluation Data selection for assessment Departing from the assessment protocol [14], literature searches for assessment ... Whereas it was stated that "the nature of the treatment received in the community comparison arm of the MTA trial is still unclear, and as a result this data is omitted from the analysis" (TAR,...
- 9
- 310
- 0
The age of complicance preparing for a riskier and more regulated world
... requirements for centralisation and decentralisation On the one hand, there needs to be a central function that can aggregate risk and compliance information from the business Without it, senior executives ... there are others you can only react 12 to, and there are some that you can prepare for and hope they don’t happen We’re trying to look at all these different situations as part of our management ... The age of compliance Preparing for a riskier and more regulated world is the judgment of the people who are managing risks on a day-to-day basis The danger I see with quantification is that the...
- 16
- 196
- 0
Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx
... Total RNA was isolated from each snake pancreas by the acid guanidinium thiocyanate/phenol/chloroform method [24] and any DNA contamination was removed by treatment with RNase-free DNase I (Stratagene) ... snakes and Japanese white rabbits were acquired, maintained and used in accordance with the Guidelines for the Care and Use of Laboratory Animals (NIH, USA; revised 1985) Analytical methods DNase ... and X laevis DNases I The aa sequences of the snake DNases I were deduced from their respective cDNAs and compared with those published for human, chicken and X laevis DNases I Position aa was...
- 8
- 500
- 0
Civil liability resulting from transfrontier environmental damage: a case for the Hague Conference? pot
... Contractual and non-Contractual Obligations (1), The Japanese Annual of International Law No 39 (1996), and Draft Articles on the Law Applicable to Contractual and non-Contractual Obligations (2), Japanese ... applies nowadays to anything which has caused damage, without distinction as to whether it was or was not activated by a human hand and without distinction as to whether it was dangerous or not ... during a transboundary movement of hazardous wastes and other wastes and their disposal, including illegal traffic, from the point where the wastes are loaded on the means of transport in an area...
- 87
- 284
- 0
lessons from deregulation telecommunications and airlines after the crunch
... higher than the fill factors the company had actually been achieving with the fact that it had adopted rate cap regulation eight years earlier was equally astounding The case for rate caps was, of ... It formally attached conditions, already accepted by the applicants—conditions such as those Michael Levine described with approval—that strengthen the assurances against clear violations of the ... mergers (and one old enough to remember how the union of the Pennsylvania and New York Central Railroads was heralded as their joint salvation), this framework for appraising the alliance makes sense...
- 102
- 322
- 0
báo cáo hóa học:" Changes in the SF-8 scores among healthy non-smoking school teachers after the enforcement of a smoke-free school policy: a comparison by passive smoke status" doc
... legislation on HRQOL of the healthy population are still unknown Odor annoyance and ocular/nasal irritation are wellknown acute symptoms of secondhand smoke [10,11], and some acute respiratory ... survey All authors read and approved the final manuscript Acknowledgements This study was supported by a Grant-in-Aid for Scientific Research from the Ministry of Health, Labor, and Welfare of Japan ... functioning The Japanese version of the SF-8 meets the standard criteria for content and for construct and criterion validity, based on the national survey covering 1,000 Japanese general citizens...
- 8
- 353
- 0
Báo cáo y học: " Osteolytic bone destruction resulting from relapse of a testicular tumour 23 years after inguinal orchiectomy and adjuvant chemotherapy: a case report" pot
... Authors’ contribution GS and TG performed the bone biopsy SE performed the histological examination BA was a major contributor in writing the manuscript All authors read and approved the final ... to strong pain, analgesia with peripheral and central analgesics was initiated During the next three days, however, the state of our patient dramatically declined and he died a day before the results ... clinically insignificant In 1984, the patient’s histopathology revealed a mixed tumour, a choriocarcinoma and an embryonic carcinoma, with retroperitoneal and pulmonary metastases To treat this, an...
- 4
- 294
- 0
báo cáo khoa học: " Changes in time-use and drug use by young adults in poor neighbourhoods of Greater Buenos Aires, Argentina, after the political transitions of 2001-2002: Results of a survey" potx
... limitations of self-report data also limit confidence in these findings Another limitation is that the analyses only measured associations and therefore no causal relationship can be established ... with these preexisting traumas to spread fear and alienation among additional youth, and this might lead some of them into substance use as a form of self-medication or escape Research on how the ... groups Conclusions We conclude with three suggestions about future research: First, research about pathways such as changed economic and social relationships and their associated implications for...
- 10
- 330
- 0
báo cáo khoa học:" Characteristics of maxillofacial injuries resulting from road traffic accidents – a 5 year review of the case records from Department of Maxillofacial Surgery in Katowice, Poland" pot
... Poland The detailed analysis was carried out on the case records of 198 patients with maxillofacial injuries resulting from traffic accidents On the basis of data from a history, examination on ... examination on admission, consultations and radiological examinations, patients' age and gender, we obtained information on the pattern of injury and detailed description of accident (the date and the time ... remain among the main reasons of maxillofacial injuries following the traumas resulting from assaults and interpersonal violence This succession of etiologic factors is in accordance with the data...
- 6
- 246
- 0
báo cáo khoa học:" Changes in the SF-8 scores among healthy non-smoking school teachers after the enforcement of a smoke-free school policy: a comparison by passive smoke status" pot
... legislation on HRQOL of the healthy population are still unknown Odor annoyance and ocular/nasal irritation are wellknown acute symptoms of secondhand smoke [10,11], and some acute respiratory ... survey All authors read and approved the final manuscript Acknowledgements This study was supported by a Grant-in-Aid for Scientific Research from the Ministry of Health, Labor, and Welfare of Japan ... functioning The Japanese version of the SF-8 meets the standard criteria for content and for construct and criterion validity, based on the national survey covering 1,000 Japanese general citizens...
- 8
- 210
- 0
Báo cáo y học: "Dynamic changes of serum SARS-Coronavirus IgG, pulmonary function and radiography in patients recovering from SARS after hospital discharge" ppt
... thickening Attention was also paid to the presence or absence of nodules or masses, cavitation or calcification, and emphysema The presence of parenchymal bands, irregular interfaces (bronchovascular, ... pulmonary signs among SARS patients Wet rales and signs of lung consolidation, as well as decreased respiration and other signs of pleural effusion can occasionally be found Note: Some patients not ... exhibited abnormal DLCO at their second pulmonary function examination, 23 at the third examination, and 20 at the fourth examination (table 4) Pulmonary fibrosis was detected by CXR and confirmed...
- 7
- 404
- 0
Báo cáo y học: "Changes in serum creatinine in the first 24 hours after cardiac arrest indicate prognosis: an observational cohort study" ppt
... statistical significance As expected, a favorable outcome was significantly associated with ventricular fibrillation as monitored as an initial rhythm, lower NSE serum levels and the application ... hypertension, chronic heart failure and chronic renal insufficiency could be identified as risk factors for renal failure after cardiac arrest and an association between acute renal failure and epinephrine ... contained by neurons and is released into the circulation after neuronal cell damage Peak serum levels reflect the amount of neuronal damage and correlate with clinical outcomes [11-13] As a...
- 7
- 311
- 0
Changes of temperature data for energy studies over time and their impact on energy consumption and CO2 emissions. The case of Athens and Thessaloniki – Greece
... Modifications in energy demand in urban areas as a result of climate changes: an assessment for the southeast Mediterranean region Energy Conversion and Management 2001, 42, 1647-56 Lebassi B., Gonzalez ... energy Use for space heating and cooling, International Organization for Standardization, 2008 [2] ASHRAE Handbook of Fundamentals, American Society of Heating, Refrigerating and AirConditioning Engineers, ... from the meteorological stations of the National Observatory of Athens (NOA) [8] and of the Aristotle University of Thessaloniki (AUTh) [9] The results for the two decades are compared and the...
- 14
- 548
- 0
Protecting water resources from pollution in the Lake Badovc
... the available measured data mentioned before, a water balance analysis was carried out for the years 2007 and 2008 The annual water abstractions of the years 2007 and 2008 exceed the corresponding ... The first step for creating the basin model is the processing the terrain data The resulting data sets are used as spatial database for the study The basin delineation was further processed and ... Pollution sources Also regarding these important planning themes no up to date information was available for the catchment area Assessing this situation, the study is prepared a questionnaire and organised...
- 10
- 530
- 0
After the Interview
... contact information and Web sites for educational associations, state departments of education, state offices of teacher certification, and state affiliates of the National Education Association ... www.nabe.org National Association for Business Teacher Education 1914 Association Dr Reston, VA 22091 703-860-8300 www.ets.uidaho.edu/standards/ national.htm National Association for the Education ... Education Association 1916 Association Dr Reston, VA 22091-1590 703-860-8000 www.naea-reston.org National Association for Bilingual Education Union Center Plaza 1220 L St NW, Ste 605 Washington,...
- 44
- 348
- 1
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25