hjelle1 rakel b forthun1 ingvild haaland1 håkon reikvam1 gry sjøholt3 øystein bruserud1 2 and bjørn t gjertsen clinical proteomics of myeloid leukemia genome med 2010 2 41

Báo cáo y học: "Natural History and Clinical Consequences of Hepatitis B Virus Infection"

Ngày tải lên : 02/11/2012, 11:17

... during their second year therapy at the rate of 2. 5% The mutation has been reported as asparagine to threonine mutation (rtN23 6T) , downstream of the YMDD motif It is not clear yet if rtN23 6T mutant ... research and understanding in this sector may bring exciting new information and better understanding of the natural history of HBV and supplement our existing armamentarium to combat this persistent ... During the stage of reactivation, majority of patients remain HBeAg negative with positive HBeAb and their clinical presentation can be HBeAg negative chornic hepatitis B, but some patients may...

5
450
0

Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx

Ngày tải lên : 19/02/2014, 06:20

... secondary structure between the wildtype stefin B or variant stefin B and the P79S mutant of the variant, consistent with tetramerization Near UV CD spectra of stefin B and the P79S mutant are also ... 20 06 FEBS ˇ E Zerovnik et al B deg·cm2–1·dmol 8000 wt stB with Cu wt stB without 6000 4000 20 00 -20 00 120 00 10000 deg·cm2–1·dmol A Copper binds to cystatin B var2 stB with Cu var2 stB without 8000 ... Cu2+ in the buffer (D) P79S mutant of variant at pH 5, 10% TFE, 25 oC, and 50 lM Cu2+ in the buffer Table Inhibition of fibrillation of stefin B proteins by Cu2+ Concentration of the protein was...

14
586
0

Báo cáo khoa học: Neuropeptide Y, B-type natriuretic peptide, substance P and peptide YY are novel substrates of fibroblast activation protein-a pdf

Ngày tải lên : 14/03/2014, 23:20

... ValboroPro inhibited the activity of DPP4 on both substrates (Fig 2B) Substrate cleavage by FAP and DPP4 After the integrity of both recombinant enzymes had been verified, the ability of FAP to cleave ... peptidase activity NPY, BNP, substance P and PYY were the most efficient FAP substrates, and the first hormone substrates of FAP to be identified These peptides are also known substrates of DPP4, and ... be at P2-P1 [9,13, 42] ; however, all four efficient dipeptidyl peptidase substrates described in this study not Substrates of fibroblast activation protein contain glycine at P2 but rather have tyrosine,...

17
425
0

Báo cáo khoa học: A mitochondrial cytochrome b mutation causing severe respiratory chain enzyme deﬁciency in humans and yeast doc

Ngày tải lên : 16/03/2014, 22:20

... suggested that the mutation had long distance effect and distorted the architecture of the Qo site FEBS Journal 27 2 (20 05) 3583–35 92 ª 20 05 FEBS E L Blakely et al Novel cytochrome b mutation in ... not noticeably different from that of the wild type strain (based on loss of activity over the course of the day and sensitivity to increased detergent concentration) This is in contrast to the ... 169 bp product into three fragments of 84 bp, 54 bp and 31 bp (band not shown) The 15 699 GﬁC mutation abolishes a restriction site for MwoI, yielding fragments of 138 bp and 31 bp and permitting...

10
317
0

Báo cáo khoa học: The b-N-acetylglucosaminidases NAG1 and NAG2 are essential for growth of Trichoderma atroviride on chitin doc

Ngày tải lên : 23/03/2014, 05:22

... nag2-term-rvnest Nag2-cds-fw hph-fw nag2-prom-test-rv ATCAGATGGCGATGTGAAGAG ACCAAGAGTTGAGCCCGTC TCTTGGGCCCTGATACAGACAC AGTTTGGGCCCTGCGAGTTTG TGGCATACAGACTGGGCG AGAACTCGGCTCCATAGGC TTGAAGAAGAGCTGCGAG TGAATGAGGATACACGGG ... 0.01), but the residual activity was still approximately 60% of that of the WT strain In addition, the ﬁnding that the sum of the NAGase activities in the Dnag1 and Dnag2 strains totalled more than ... A 523 , and DD-I and DD-II are Dnag1Dnag2 strains 713 and 1 921 , respectively cultures, but no differences between the knockout strains and the WT could be detected with respect to the timing and...

12
456
0

Báo cáo khoa học: Nuclear factor kappa B and tumor necrosis factor-alpha modulation of transcription of the mouse testis- and pre-implantation development-speciﬁc Rnf33⁄Trim60 gene pot

Ngày tải lên : 29/03/2014, 00:20

... further supported by the assay of the triple mutant F1MutjB ⁄ H ⁄ G that yielded luciferase activities similar to that obtained with the jB-only mutant construct To conﬁrm the contribution of jB ... reaction, PCR was carried out using primer F1466 (5¢-GTGTGTGTCAAGCCCACTTTTCTG-3¢) of the coding sequence and primer R1863 (5¢-GTGGG TGGTGGATTTTGTTGTTTG-3¢) of the 3¢-UTR sequence of Rnf33 to generate ... in the testis [21 23 ] Expression of p50 and p65 was conﬁrmed in the testis and established in the TM3 and TM4 testicular cell lines by RT-PCR and western blot analyses (Fig 5) It is noted in the...

14
381
0

báo cáo hóa học:" Intrinsic and extrinsic factors influencing the clinical course of B-cell chronic lymphocytic leukemia: prognostic markers with pathogenetic relevance" docx

Ngày tải lên : 18/06/2014, 15:20

... interaction, like Nutlins, could represent a new therapeutic strategy for treatment of CLL patients [37] In CLL, TP53 is mutated in about 10% of patients at presentation and in 10% to 30% of patients ... interests 12 Authors' contributions MDB wrote the manuscript, FB, FF, AZ, RB, RM, SD, LL, DGE, GG, GDP contributed to write the manuscript and VG contributed to write and revised the manuscript ... Functional integrity of the p53-mediated apoptotic pathway induced by the nongenotoxic agent nutlin-3 in B- cell chronic lymphocytic leukemia (B- CLL) Blood 20 06, 107:4 122 -4 129 Shanafelt TD, Witzig...

14
640
0

Báo cáo hóa học: "Quantification of newly produced B and T lymphocytes in untreated chronic lymphocytic leukemia patients" ppt

Ngày tải lên : 18/06/2014, 16:20

... antibodies The percentage of Th cells and CTL is obtained after gating on lymphocytes, that of naive Th cells, Treg, TEM and TCM after gating on Th cells, and that of thymicnaive Th cells after ... decreased number of Treg observed by Beyer et al [20 ] This discrepancy may be due to the fact that these authors preferentially analyzed patients at later disease stage (Binet stage B and C), and because ... Renewal of the T- cell compartment in multiple sclerosis patients treated with glatiramer acetate Mult Scler 20 10, 16 :21 8 -22 7 12 Haas J, Fritzsching B, Trübswetter P, Korporal M, Milkova L, Fritz B, ...

7
559
0

Báo cáo sinh học: " Hepatitis B virus (HBV) genotypes in Egyptian pediatric cancer patients with acute and chronic active HBV infection" pptx

Ngày tải lên : 18/06/2014, 18:20

... al [28 ] that showed that genotype B was more prevalent in patients with FH and AH They attributed this result to the possibility that Genotype B virus may have the motifs that strongly bind to ... Genotype D appears to predominate in the Mediterranean basin and the Middle East, and Table 2: Subjects N = 70 HBV genotypes A Acute hepatitis (22 ) Chronic* active hepatitis (48) Total B C D mixed (9%) ... Chi-square test P values less than 0.05 were considered statistically significant Results Distribution of HBV genotypes This study showed that HBV infections in pediatric cancer patients are attributed...

7
415
0

Báo cáo hóa học: " Hepatitis B virus (HBV) genotypes in Egyptian pediatric cancer patients with acute and chronic active HBV infection" ppt

Ngày tải lên : 20/06/2014, 01:20

... al [28 ] that showed that genotype B was more prevalent in patients with FH and AH They attributed this result to the possibility that Genotype B virus may have the motifs that strongly bind to ... Genotype D appears to predominate in the Mediterranean basin and the Middle East, and Table 2: Subjects N = 70 HBV genotypes A Acute hepatitis (22 ) Chronic* active hepatitis (48) Total B C D mixed (9%) ... Chi-square test P values less than 0.05 were considered statistically significant Results Distribution of HBV genotypes This study showed that HBV infections in pediatric cancer patients are attributed...

7
454
0

Báo cáo hóa học: " Clinical significance of elevated B-type natriuretic peptide in patients with acute lung injury with or without right ventricular dilatation: an observational cohort study" potx

Ngày tải lên : 21/06/2014, 03:20

... collected at the time of enrollment in tubes containing potassium EDTA and was measured by clinical laboratory personnel blinded to the clinical status of the patients The measurement was done with ... dilatation Thus, our study suggests that BNP elevation in the early stages of ALI may not be caused by RV strain alone BNP has been established to be a predictor of mortality in a variety of chronic and ... results Also, in their study, 52% of the patients with ALI were in shock, and BNP has been shown to predict mortality in patients with shock Because the authors did not stratify for the presence of...

7
446
0

b.a thesis a comparative study on making requests in vietnamese and english in terms of politeness

Ngày tải lên : 05/07/2014, 08:03

... Also, the three factors of gender, age and social status more and less affect their selection of request strategies iii Table of Contents Acknowledgment Abstract Abbreviations Chapter INTRODUCTION ... attention? The sentence is a request more than a question The distance between what is said and what is meant, and the multiple layers of meaning between the literal meaning of utterance and the ... divided into direct and indirect ones Both direct and indirect requests are described as types above The first five ones belong to direct strategy and the last four ones belong to indirect strategy...

79
892
4

Adamsen, Paul B. - Frameworks for Complex System Development [CRC Press 2000] Episode 2 Part 1 ppt