his life in an autobiographical chapter and in a selected series of his published letters
Charles Darwin: His Life in an1Charles Darwin: His Life in anAutobiographical Chapter, and in a Selected Series of His Published Letters, by Charles Darwin, Edited by Sir Francis Darwin This eBook is for the use of anyone anywhere at no cost and with potx
Ngày tải lên :
23/03/2014, 05:20
... with pleasant talk his whole manner was wonderfully bright and animated, and his face shared to the full in the general animation His laugh was a free and sounding peal, like that of a man who ... islands, for instance, St Helena Nor must I pass over the discovery of the singular relations of the animals and plants inhabiting the several islands of the Galapagos archipelago, and of all of them ... vanity has always made me regret, namely, the explanation by means of the Glacial period of the presence of the same species of plants and of some few animals on distant mountain summits and in...
- 245
- 605
- 0
báo cáo hóa học:" Health-related quality of life in a clinical sample of obese children and adolescents" pptx
Ngày tải lên :
20/06/2014, 15:20
... manuscript SS and ID collected the data ID, CE and SM were involved in guiding the study including the design and coordination All authors contributed to the interpretation of data and writing ... RAH, Wit JM, Verloove-Vanhorick SP: Alarming prevalences of overweight and obesity for children of Turkish, 28 29 30 Moroccan and Dutch origin in The Netherlands according to international standards ... standards Acta Paediatrica 2005, 94:496-498 Meltzer H, Gatward R, Goodman R, et al: Mental Health of Children and Adolescents in Great Britain HMSO, London; 2000 Stansfeld SA, Haines MM, Head JA,...
- 6
- 375
- 0
Báo cáo y học: "Circulating immune complexes and complement C3 and C4 levels in a selected group of patients with rhinitis in Lebanon" pot
Ngày tải lên :
13/08/2014, 13:22
... histamine release and Iikura et al [18] reported that immobilized secretory IgA on Sepharose beads was capable of inducing basophil degranulation and histamine release The presence of IgA containing-immune ... (65.5%) Dermatophagoides pteronyssinus (Dpt) was the causative allergen in 62, Dermatophagoides farinae (Df) in 58, cat hair dander in 23 and dog hair dander in patients (some patients were allergic ... development, and allergen sensitization in infants at high risk of asthma Lancet 2000, 13(355 (9216)):1680-1683 Andersson M, Laukkanen M, Salkinojasalonen M: 3-Hydroxy fatty acids: Stable indicators of...
- 4
- 221
- 0
Báo cáo y học: "The Nordic Maintenance Care Program – An interview study on the use of maintenance care in a selected group of Danish chiropractors" pdf
Ngày tải lên :
13/08/2014, 14:20
... standard management programs Rather, their responses indicated that maintenance care can be used for any type of low back pain with the intent of improving spinal function in order to avoid a ... and three mentioned an interval of months They also mentioned that the timing of appointments would vary with the needs of the patient Duration of maintenance care program Aim of the maintenance ... symptom-guided and clinical findings-guided maintenance care were noted for the remaining scenarios Some type of maintenance care was the most common answer for scenarios 2, and The largest degree of consensus...
- 7
- 420
- 0
Tài liệu Psychometric properties of the quality of life scale Child Health and Illness Profile-Child Edition in a combined analysis of five atomoxetine trials pdf
Ngày tải lên :
12/02/2014, 19:20
... 340 Table Cronbach’s alpha (standardized) for the subdomains and the lowest alpha that was reached by deleting an item in that sub-domain with 95% CIs A Schacht et al Sub-domains At baseline At ... editing and support Conflict of interest The study was sponsored by Eli Lilly and Company AS and RE are employees and shareholders of Eli Lilly and Company RE and TW were employees of Eli Lilly and ... Mean ADHD-RS total score at baseline was 41.8 (SD 8.04), the 123 338 A Schacht et al Table Descriptive analysis (mean and SD) of CHIP-CE total score, domains, and sub-domains at baseline based...
- 15
- 1.2K
- 0
báo cáo hóa học: " The health-related quality of life in rheumatoid arthritis, ankylosing spondylitis, and psoriatic arthritis: a comparison with a selected sample of healthy people" potx
Ngày tải lên :
18/06/2014, 19:20
... Disease activity in patients with AS and axial PsA was measured with the BASDAI [24] The BASDAI consists of VAS relating to major symptoms relevant to AS: fatigue, spinal pain, joint pain, localized ... musculoskeletal pain and physical function in the community and has been associated with a higher prevalence of work disability and greater disease activity in patients with AS and RA [9,38] The mechanism ... for categorial variables and analysis of variance (ANOVA) for continuous variables Standardized difference scores (the s-score or normal score) were also calculated by subtracting the mean scores...
- 12
- 466
- 0
báo cáo hóa học:" Osteoarthritis: quality of life, comorbidities, medication and health service utilization assessed in a large sample of primary care patients" potx
Ngày tải lên :
20/06/2014, 00:20
... care as well as patients' quality of life by tailored interventions A randomly created sample of 75 general practitioners in the area of Baden-Wuerttemberg and Bavaria has been enrolled and recruited ... covariates as mentioned above More than a quarter of the patients received some acupuncture during the last half year and nearly a quarter visited a traditional healer at least once ANCOVAs revealed ... that the German health care system is characterized by a high physician contact-rate The number of mean contacts per year and person in Germany, including all contacts to GPs and specialists, is...
- 9
- 413
- 0
Báo cáo y học: "Identification of an endogenous retroviral envelope gene with fusogenic activity and placenta-specific expression in the rabbit: a new "syncytin" in a third order of mammals" ppt
Ngày tải lên :
12/08/2014, 23:22
... 5'TTCCTGAGGGCTCACTGATTAAC and 5'-GAAGGGGAGAGTCAGTTGTTGGAG (external to the ORF) or 5'AGACTGCGGAGATAAAACTGC and 5'-gataaaggtcatcagcctattga (internal to the ORF) PCR products were then cloned in pGEM-T ... d'Expérimentation Animale and INRA (Jouy en Josas, France) for animal care We thank Christian Lavialle for comments and critical reading of the manuscript This work was supported by the CNRS and a fellowship ... cellular and a syncytial trophophoblast layer separating maternal and fetal blood spaces (maternal lacuna, ml, and fetal vessels, fv) All of these characterize the definitive labyrinthine placenta...
- 11
- 354
- 0
Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"
Ngày tải lên :
03/11/2012, 11:44
... EAT patients Panel A: Quantity and duration of episodes and the associated symptoms Panel B: Detraction in daily life generally and in parts of daily life variable PANAL A Detraction in daily life ... (5) and insufficient (6)) Patients with AVNRT, AVRT and EAT rated their state of health before and after ablation The changes within the ranking scale before and after ablation is demonstrated in ... defective (5) and insufficient (6) Y-axis: Percentage of patients Panel A: AVNRT Panel B: AVRT Panel C: EAT Comparing the categorical variables before and after ablation in AVNRT patients, applying the...
- 9
- 679
- 0
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx
Ngày tải lên :
15/02/2014, 01:20
... Pro transmission scanner (Epson, Nagano, Japan) and analyzed with imagemaster 2d platinum software, version 5.0 (GE Healthcare) Spots were detected automatically by the software and manually refined; ... actin bundles regulator fascin [27] and discordant changes 4914 of two calcium-dependent, actin-associated proteins (annexins A2 and A5 ), both regulating membrane dynamics, cell migration, proliferation ... mitochondrial Peroxiredoxin Annexin A5 Annexin A2 Aldolase A Fascin Pyruvate kinase VDAC-2 Stathmin Ran1BP GSTp C1qBP Profilin Enolase RuvB-like CRMP4 Lamin A ⁄ C Mitofilin, p32 GAPDH ATP synthase a P05387...
- 11
- 775
- 0
Factors related to quality of life in long-term survivors of gynecological cancer doc
Ngày tải lên :
05/03/2014, 15:20
... conceptualization of life quality can change over the course of the disease trajectory Many cancer survivors desire to return to ‘normal’ after cancer, taking and keeping control, and maintaining a coherent ... well as cancerspecific instruments, such as European Organization of Research and Treatment of Cancer (EORTC) and Functional Assessment of Cancer Therapy (FACT), have been widely used in cancer ... field Same as healthy in general, cognitive and emotional fields Lower in physical and social fields Same as or better than healthy Same as controls Low in ovarian and radiation patients Same scores...
- 9
- 587
- 0
Minimum Wages and Employment: A Case Study of the Fast-Food Industry in New Jersey and Pennsylvania pot
Ngày tải lên :
08/03/2014, 06:20
... e sample consists of 357 stores with available data o n employment and starting wages in waves and T h e dependent variable in all models is change in F T E employment T h e mean and standard ... definitions Standard errors are given in parentheses aTest of equality of means in New Jersey and Pennsylvania restaurants in New Jersey that had been paying less than $5.05 per hour reported a ... excludes managers and assistant managers e CFull-time equivalent employment equals number of managers, assistant managers, and full-time nonmanage- ment workers, plus 0.4 times the number of part-time...
- 26
- 869
- 0
Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, MI 48106-1346 USA 800-521-0600UMI.The Potential of Soil Survey Data in a Quantitative Evaluation of Surficial Geology Mapping in Northern Maine by Rosalia EvansThesis submitted t pptx
Ngày tải lên :
08/03/2014, 23:20
... stony loam Machias gravelly loam Machias gravelly loam Machias gravelly loam Madawaska fine sandy loam Madawaska fine sandy loam Madawaska fine sandy loam Made land Mapleton shaly silt loam Mapleton ... loams Fredon and Halsey silt loams Fredon and Halsey silt loams Hadley silt loam Hadley silt loam Howland gravelly loam Howland gravelly loam Howland gravelly loam Howland very stony loam Howland ... kame terrace Glaciolacustrine originating as a blanket formation and a deltaic formation Colluvium originating on a kame terrace Organic swamp originating as a blanket formation Residuum originating...
- 131
- 599
- 0
Báo cáo khoa học: E2A participates in a fine control of pre-mature B-cell apoptosis mediated by B-cell receptor signaling via transcriptional regulation of survivin, IAP2 and caspase-8 genes pot
Ngày tải lên :
16/03/2014, 04:20
... electrophoresis, and analyzed using an LAS-1000plus luminescent image analyzer (Fujifilm, Tokyo, Japan) We thank Y Takami and H Suzuki for technical support and H K Barman for editorial reading of the manuscript ... factors, caspases, caspase-regulating factors and CAD/ICAD led to changes in the activities of caspase-3, caspase-8 and caspase-9, and in the protein levels of IAP2 and ICAD (Fig 4A, B), consistent ... the inhibitors survivin and IAP2 (and also FLIP and IAP1) The slightly decreased caspase-8 activity mediated by PMA/ionomycin treatment in E 2A) /) may have resulted from the balanced mRNA (and...
- 11
- 349
- 0
Army Life in a Black Regiment ppt
Ngày tải lên :
17/03/2014, 16:20
... event of Thanksgiving-Day; they have had company and regimental prize-shootings, a minimum of speeches and a maximum of dinner Bill of fare: two beef-cattle and a thousand oranges The oranges ... prayer-meetings as late as they desired; and all night, as I waked at intervals, I could hear them praying and "shouting" and clattering with hands and heels It seemed to make them very happy, and appeared ... and irreverent till I revealed myself, and then rather cowed and anxious, fearing to have offended It rained harder and harder, and when I had nearly made the rounds I had had enough of it, and, ...
- 133
- 330
- 0
Gender inequality in health among elderly people in a combined framework of socioeconomic position, family characteristics and social support doc
Ngày tải lên :
22/03/2014, 14:20
... Silvia Rueda and Luc a Artazcoz Ferraro, K and Famer, M 1996 Double jeopardy Aging as leveler, or persistant health inequality ? A longitudinal analysis of white and black Americans Journal of ... Muntaner, C., Benach, J and Artazcoz, L 2004 Social class and selfreported health status among men and women: what is the role of work organisation, household material standards and household labour ... variables measuring household material standards and generated by combining the following five items : having a shower and/ or a bath, having hot running water, having central or dispersed heating,...
- 23
- 420
- 0
IMPACT OF MATERNAL AND CHILD HEALTH STRATEGY ON CHILD SURVIVAL IN A RURAL COMMUNITY OF PONDICHERRY pptx
Ngày tải lên :
28/03/2014, 11:20
... prevention and management of birth asphyxia in the community: In: A Global Strategy for Prevention and Management of Birth Asphyxia Through Maternal and Newborn Care at Primary Health Care Level in Developing ... Welfare 1983; pp 1-7 11 Srinivasa DK, Danabalan M, Anand D Infant mortality trends in a rural health center of Pondicherry J Indian Med Assoc 1974; 62: 39-43 12 Kumar V, Raina N Experiences in ... were not available Information on maternal characteristics, antenatal care, delivery details were collected by reviewing the antenatal, birth and immunization registers maintained at the health center...
- 8
- 403
- 0
Finding Surprising Patterns in a Time Series Database in Linear Time and Space pdf
Ngày tải lên :
30/03/2014, 13:20
... 6e foăha9{9Dj#fD`ệo(`p$D(D9D`(Dệy 10 ba$ ba$ 11 aba $ 12 14 aba $ 13 15 aba $ 16 ba$ aba ba$ $ aba ba$ aba $ $ aba aba $ aba $ ba 18 aba aba $ ba 17 aba 19 aba w b B V ... Ô9DD1găƯ$AG(9ipA9Dgiq(Ưf#D(i34ÔDGfwcT PT X b CF B @ C B @ X eT ự E e C R S S B C V R T c(Ô9ÔGqfa#DwDcệÂujD$(Ô(YqYtă7WhÔÂG a b a a b a b a a b a a b a b a a b a b a $ $ ba 20 $ ba aba $ aba ... $dÔf9sêƠ 2A2 iâx9 '#ọƯ(ădad|rri 1l Tarzan d |R| 0.005 128 256 512 1024 2048 4096 8192 16384 32768 65536 0.01 0.015 0.02 average of |z(w)| 0.025 0.03 0.035 0.04 0.045 random.dat 0.05...
- 11
- 485
- 0
báo cáo hóa học: " Health-related quality of life in diabetes: The associations of complications with EQ-5D scores" potx
Ngày tải lên :
18/06/2014, 19:20
... 27:1047-1053 Grandy S, Fox K: EQ-5D visual analog scale and utility index values in individuals with diabetes and at risk for diabetes: Findings from the Study to Help Improve Early evaluation and management ... dimension Age, ischemic heart disease and neuropathy had an impact on the PAIN/DISCOMFORT dimension, and age, impaired vision, ischemic heart disease, neuropathy and fear of hypoglycaemia had an impact ... impact on overall HRQoL in both types of diabetes, while ischemic heart disease and social limitations had an impact on those with type diabetes, and fear of hypoglycaemia and limitations at...
- 8
- 426
- 0