hdl associated paraoxonase 1 gene polymorphisms as a genetic markers for wide spread diseases
Báo cáo y học: "Characterization of the HIV-1 RNA associated proteome identifies Matrin 3 as a nuclear cofactor of Rev function" ppsx
Ngày tải lên :
13/08/2014, 01:21
... cold PBS and lysed in RIPA buffer (50 mM Tris-Cl; pH 7.5, 1% NP-40, 0.05% SDS, 15 0 mM CGAGATCCGTTCACTAATCGAATG B GGATTAACTGCGAATCGTTCTAGC C CGAGATCCGTTCACTAATCGAATG BA1 (b-actin) CATGTGCAAGGCCGGCTTCG ... MATR3 siGENOME SmartPool (UAGAUGAACUGAGUCGUUA, GACCAGGCCAGUAACAUUU, ACCCA GUGCUUGAUUAUGA, CCAGUGAGAGUUCAUUU AU), siGENOME Non-Targeting siRNA Pool #1 Either HeLa cells or 293T cells were transfected ... and Maayan Salton (Tel Aviv University, Israel, 1: 10000); p17 (NIH AIDS Reference Reagents Program, 1: 1000); GFP (Roche, 11 814 4600 01, 1: 1000); flag (Sigma, F1804, 1: 1000); a- tubulin (Sigma, T 516 8,...
- 15
- 470
- 0
Paraoxonase (PON1) polymorphisms as a biomarker of susceptibility to organophosphate toxicity among a cohort of singaporean workers
Ngày tải lên :
28/11/2015, 13:27
... substrate name to define PON1 activity e.g paraoxonase if the substrate was paraoxon, “diazoxonase” if the substrate was diazoxon and “arylesterase activity” if the substrate was phenylacetate ... polymorphism was amplified using forward 5´- CCT GCA ATA ATA TGA AAC AAC CTG -3´ and reverse 5- ´TGA AAG ACT TAA ACT GCC AGT C -3´ (Sardo et al 2005) Reaction mixture was 39 prepared according to ... has not yet been discovered Harel et al (2007) postulated that the lactonase and esterase functions of PONs are catalysed by a His 115 -His134 dyad, and that paraoxonase activity is probably catalysed...
- 130
- 315
- 0
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc
Ngày tải lên :
18/02/2014, 16:20
... (Promega, Madison, WT, USA) using the primers 5¢-CACACTACACTGGGAAGCAGAGACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG3¢ The cDNA was subcloned into the EcoRV site of pBluescript SK(+) (Stratagene, ... Drosophila segment FEBS Journal 275 (2008) 318 –3 31 ª 2007 The Authors Journal compilation ª 2007 FEBS 329 A negative regulator for palmitoylation of Shh 10 11 12 13 14 15 16 330 Y Abe et al polarity gene ... Chem 275, 10 995 11 0 01 Tanaka Hall TM, Porter JA, Beachy PA & Leahy DJ (19 95) A potential catalytic site revealed by the 1. 7Angstrom crystal structure of the amino-terminal signalling domain of Sonic...
- 14
- 499
- 0
Báo cáo Y học: Cloning and characterization of the mammalian-specific nicolin 1 gene (NICN1) encoding a nuclear 24 kDa protein doc
Ngày tải lên :
23/03/2014, 21:20
... CTTGAGgtaagctctctaaca 3 71 bp (exon 5, 10 5 bp) 600 … TTCGACgtgagtaacagtgtc 74 bp (exon 6, 14 31 bp) 20 31 … AATAAATACTTGTGGAATATG Exon 5¢-splice site aaacgttatgtggccTGGGAG … 13 3 (exon 1, 234 bp) tcgtttgtattctagTTGCAG ... Izawa, M., Nishi, K., Kiyosawa, H., Kondo, S., Yamanaka, I., Saito, T., Okazaki, Y., Gojobori, T., Bono, H., Kasukawa, T., Saito, R., Kadota, K., Matsuda, H., Ashburner, M., Batalov, S., Casavant, ... Intron phase Intron size … TTCGAGgtgagcaacccccca 309 2647 bp (exon 2, 17 7 bp) … CACCAGgtcagctgggcctca 423 418 bp (exon 3, 11 4 bp) … CCAAAGgcaagtgactttgca 4 01 bp (exon 4, 72 bp) 495 … CTTGAGgtaagctctctaaca...
- 6
- 450
- 0
Báo cáo y học: "Herpes simplex 1 encephalitis presenting as a brain haemorrhage with normal cerebrospinal fluid analysis: a case report" pot
Ngày tải lên :
11/08/2014, 19:21
... mentation, visual hallucinations as well as auditory hallucinations On direct questioning, he also admitted to subjective perineal paraesthesias and dysaesthesias, without any rash present and the feeling ... circumscribed brain haemorrhage The patient was transferred to our hospital for further management On admission, the patient was complaining of subjective fever and headache He was febrile with a tympanic ... tandem walking, albeit characteristically slowly A chest X-ray was normal Urine analysis and blood cultures were repeated The patient was started on ceftriaxone, doxycycline and acyclovir and a CT...
- 4
- 216
- 0
Báo cáo y học: "Using single nucleotide polymorphisms as a means to understanding the pathophysiology of asthma" pps
Ngày tải lên :
12/08/2014, 18:20
... Hopkin JM: Atopy and asthma: genetic variants of IL-4 and IL -13 signalling Immunol Today 2000, 21: 60–64 10 5 Takabayashi A, Ihara K, Sasaki Y, Suzuki Y, Nishima S, Izuhara K, Hamasaki N, Hara T: Childhood ... genome -wide screen for asthma -associated quantitative trait loci in a mouse model of allergic asthma Hum Mol Genet 19 99, 8:6 01 605 81 MacLean JA, De Sanctis GT, Ackerman KG, Drazen JM, Sauty A, DeHaan ... emphasis away from linkage analysis and microsatellite markers towards SNP genotyping and different analytical strategies based on association and haplotype analysis [ 31 34] Association analyses are...
- 11
- 491
- 0
Báo cáo y học: "Latent Membrane Protein 1 as a molecular adjuvant for single-cycle lentiviral vaccines" pot
Ngày tải lên :
13/08/2014, 01:20
... LMP1 and LMP1-CD40 as vaccine adjuvants, naming GWS and RSK as inventors Page 11 of 12 Received: February 2 011 Accepted: 18 May 2 011 Published: 18 May 2 011 References Tripp CS, Wolf SF, Unanue ... vaccine strategies In addition, LMP1 and LMP1 chimeras could be used as viral vector vaccine adjuvants or adjuvants for DNA or RNA based vaccines Use of LMP1 for Gupta et al Retrovirology 2 011 , ... Total cellular RNA was isolated, reverse transcribed to cDNA and MIP- 1a, MIP1b, and RANTES mRNA expression was analyzed by real time PCR assay When macrophages were infected with recombinant...
- 12
- 219
- 0
Báo cáo y học: " APOBEC3G-UBA2 fusion as a potential strategy for stable expression of APOBEC3G and inhibition of HIV-1 replication" pot
Ngày tải lên :
13/08/2014, 05:21
... 5'-ATCCAAGACGGAATTCGTTTTCCTGATTCTGGAG-3' The UBA2 gene fragment was amplified from plasmid pcDNA3.1HHR2 3A by PCR The 5' primer used was 5'ATCCAAGACGGAATTCACGCCGCAGGAGAAAGAAGCTATAG-3'; the 3' primer for the APOPEC3G-UBA2 ... proteasome-interacting factors Rad23 and Rpn10 of Saccharomyces cerevisiae Genetics 19 99, 15 3 (1) :69-79 Hiyama H, Yokoi M, Masutani C, Sugasawa K, Maekawa T, Tanaka K, Hoeijmakers JH, Hanaoka F: ... the APOPEC3G-UBA2 fusion was 5'-ATCGTACTCGAAGCTTCTAACTCAGGAGGAAGTTGGCAG-3'; and the 3' primer for the APOPEC3G-UBA2* fusion was 5'-ATCGTACTCGAAGCTTCTAACTCAGagcGAAGTTGGCAG-3' Purified PCR products...
- 13
- 254
- 0
Báo cáo sinh học: "Silencing the epidermal growth factor receptor gene with RNAi may be developed as a potential therapy for non small cell lung cancer" pot
Ngày tải lên :
14/08/2014, 19:22
... were as follows: EGFR gene forward primer, 5' -CGAGGGCAAATACAGCTTTG -3'; backward primer, 5'- CCTTCGCACTTCTTACACTTG -3'; probe 5'FAM-ACGCCGTCTTCCTCCATCTCATA GCTAMRA3' Thermal cycler parameters ... inhibitors in cancer therapy Cancer Cell 2002, 1: 117 -12 3 Baselga J: The EGFR as a target for anticancer therapy – focus on cetuximab Eur J Cancer 20 01, 37:S16-22 Tamm I, Dorken B, Hartmann G: Antisense ... reading of the manuscript References 10 11 12 13 14 15 16 17 18 McLennan G., Roder DM: Lung cancer in Australia Med J Aust 19 89, 15 0:206-207 Burton RC: Cancer control in Australia: into the 21...
- 12
- 314
- 0
Epigenetic control of neuronal activity dependent gene transcription as a basis for long term memory formation
Ngày tải lên :
09/09/2015, 08:13
... when I was first trying to walk (aka run gels), Rajaram Ezhilarasan for the hard work and dedication, Niamh Higgins, Knvul Sheikh, Annabel Tan, Gokul Banumurthy our amazing RA’s who work day and ... C ARC: a master regulator of synaptic plasticity 11 D TIP60: an effector of early and late neuroepigenetic events 15 E PHF8: a specialized neuronal transcriptional co-activator 16 III ... receptors60, and Voltage-Gated Calcium Channels 61 may all play a role in regulating Arc expression, the precise signaling cascades that connect 12 synaptic activity with the actual transcription of Arc gene...
- 150
- 430
- 0
Novel design of a compacted micro-structured air-breathing PEM fuel cell as a power source for mobile phones
Ngày tải lên :
05/09/2013, 14:58
... Santiago J.G Engineering model of a passive planar air breathing fuel cell cathode J Power Sources 2007, 16 7 (1) , 11 8 12 9 [3] Rajani B.P.M and Kolar A. K A model for a vertical planar air breathing ... 0) and condensation ( m phase < 0) is assumed Where m phase is mass transfer: for evaporation & & & & ( m phase = mevap ) and for condensation ( m phase = mcond ) (kg/s) So that the mass balance ... paper [10 ] was used to account for the magnitude of phase change inside the GDL 2.2.3 Catalyst layers The catalyst layer is treated as a thin interface, where sink and source terms for the reactants...
- 18
- 549
- 0
Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry
Ngày tải lên :
05/09/2013, 15:28
... α-arabinofuranosidases and α-Larabinases that release arabinan [ 31] , α-glucuronidases that release glucoronic acids, acetyl xylan esterases that hydrolyze acetylester bonds, ferulic acid esterases that ... groups are removed forming acetic acid Organic solvent such as acetone can be used to precipitate and separate the fractionated biomass The pretreatment has an advantage of operating at low temperature ... fatty acids and fatty alcohols, sterols and alkanes Natural waxes have a wide range of industrial uses in cosmetics, polishes and coatings, pharmaceuticals, and insecticides Wheat straw contains...
- 20
- 437
- 0
Tài liệu Báo cáo khoa học: Peroxiredoxin II functions as a signal terminator for H2O2-activated phospholipase D1 doc
Ngày tải lên :
20/02/2014, 01:20
... nitrilotriacetate ⁄ agarose (Qiagen, Valencia, CA, USA), and rocked at °C for h The lysate ⁄ Ni ⁄ nitrilotriacetate bead mixture was transferred to a poly prep chromatography column and the agarose packed ... 7.5, 15 0 mm NaCl, and · protease inhibitor cocktail at 37 °C for 20 The lysate was spun down at 50 000 g for 15 The supernatant was mixed with pre-equilibrated anti-HA affinity matrix and rocked at ... not affect basal PLD1 activity or PMA-stimulated PLD1 activation, but completely ablated stimulation of PLD1 by H2O2 This shows that PrxII can function as a negative regulator of PLD1 activation...
- 9
- 401
- 0
Tài liệu BÁO CÁO " LIPID PRODUCTION FROM MICROALGAE AS A PROMISING CANDIDATE FOR BIODIESEL PRODUCTION " ppt
Ngày tải lên :
21/02/2014, 10:20
... 48 MAKARA, TEKNOLOGI, VOL 13 , NO 1, APRIL 2009: 47- 51 energy crops [6-7] Microalgae systems also use far less water than traditional oilseed crops For these reasons, microalgae are capable of ... extracted The effect of drying temperature was investigated in this study Gas chromatography analysis Sample was dissolved in ethyl acetate and 0.5 µL of this was injected into a Shimadzu GC -17 A ... that increasing CO2 concentration of up to 1% of air will increase lipid produced by algae was given in Table As shown in this table, cell concentration obtained after 20 days incubation was...
- 5
- 396
- 1
Tài liệu BÁO CÁO " LIPID PRODUCTION FROM MICROALGAE AS A PROMISING CANDIDATE FOR BIODIESEL PRODUCTION " docx
Ngày tải lên :
21/02/2014, 10:20
... 48 MAKARA, TEKNOLOGI, VOL 13 , NO 1, APRIL 2009: 47- 51 energy crops [6-7] Microalgae systems also use far less water than traditional oilseed crops For these reasons, microalgae are capable of ... extracted The effect of drying temperature was investigated in this study Gas chromatography analysis Sample was dissolved in ethyl acetate and 0.5 µL of this was injected into a Shimadzu GC -17 A ... that increasing CO2 concentration of up to 1% of air will increase lipid produced by algae was given in Table As shown in this table, cell concentration obtained after 20 days incubation was...
- 5
- 345
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
Ngày tải lên :
07/03/2014, 10:20
... MF (19 94) Oxidative damage to mitochondrial DNA is increased in Alzheimer’s disease Ann Neurol 36, 747–7 51 Modulation of metal availability for treating AD 81 Maynard CJ, Cappai R, Volitakis ... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 ... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors...
- 9
- 634
- 0
Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt
Ngày tải lên :
16/03/2014, 05:20
... was stored at ) 80 °C for analysis for metals Paraffin sections lm thick were prepared and stained with hematoxylin and eosin The gonadal maturity of each animal was classified into five stages according ... measured by the Bradford method [ 51] using a Bio-Rad protein assay (Bio-Rad, Hercules, CA, USA) with bovine c-globulin as a standard Thyroglobulin (669 kDa), catalase (232 kDa), BSA (67 kDa) and ... substrate for localization of the labeled MYP Statistical analysis Data were expressed as the mean ± SEM Statistical analysis was performed using instat software (GraphPad Software) The normality...
- 14
- 442
- 0
Báo cáo khoa học: Structure, epitope mapping, and docking simulation of a gibberellin mimic peptide as a peptidyl mimotope for a hydrophobic ligand pot
Ngày tải lên :
16/03/2014, 23:20
... peptide-antibody recognition 11 Murata T, Fushinobu S, Nakajima M, Asami O, Sassa T, Wakagi T & Yamaguchi I (2002) Crystal structure of the liganded anti-gibberellin A4 antibody 4-B8(8) ⁄ E9 Fab fragment ... function was applied to the t1 and t2 dimensions Peak picking and assignment were performed with sparky (T D Goddard and D G Kneller, sparky 3, University of California, San Francisco, CA) 1D and 2D ... induction decay values with on- and off-resonance protein saturation were recorded in alternative fashion Subtraction of the 1D STD spectra was achieved via phase cycling Protein resonance was suppressed...
- 11
- 565
- 0
Báo cáo khoa học: "DATR AS A LEXICAL COMPONENT FOR PATR" pot
Ngày tải lên :
18/03/2014, 02:20
... OF DATR DATR (described in detail by Evans/ Gazdar, 19 8 9a; 19 89b; 19 90)is a declarative language for the definition of semantic networks which allows for defaults as well as multiple inheritance ... lexical information encoded in (1) The question that arises is how to relate DATR and PATR so that the hierarchically structured lexical information in DATR can be made available in PATR-usable ... Queries that the grammar writer has stated explicitly have to be passed on to DATR Every query together with the resulthag value has to be transformed into a PATR path equation (that partially describes...
- 6
- 388
- 0
Báo cáo khoa học: Fatty acid omega-oxidation as a rescue pathway for fatty acid oxidation disorders in humans pot
Ngày tải lên :
22/03/2014, 16:21
... ACADM ACADS HADHA HADHB HADHA HADHB HADHSC ACAA2 ETFDH ETFA ETFB DECR1 CPT 1A CACT CPT2 VLCAD MCAD SCAD LCHAD LCKAT LCHAD LCKAT SCHAD MCKAT ETFDH ETFa ETFb DECR1 11 q13 3p 21 1p32 17 p 11 1p 31 12q22 ... carnitine palmitoyltransferase I, mitochondrial carnitine acylcarnitine translocase and carnitine palmitoyltransferase II [5–7] In case of the straight-chain and 2-methyl-branched chain FAs, b-oxidation ... long-chain fatty acids (VLCFAs), notably C24:0 and C26:0; (b) pristanic acid (2,6 ,10 ,14 -tetramethylpentadecanoic acid), as FEBS Journal 278 (2 011 ) 18 2 19 4 ª 2 010 The Authors Journal compilation ª 2 010 ...
- 13
- 475
- 0