having worked on a variety of projects across the region
Issues Receiving A Variety Of Considerations During The Verification Process Of The Law Project On Preventing, Protecting Against, And Miltigatiing Disaster
... agency and steering departments were established, along with system of professional organizations on PPD such as in Thailand, Philippines, Indonesia, Japan… 17 Recommendation of the model appropriate ... map in Quảng Bình…) 5.2 On rescue, life saving: • Clarify the role of military force • Add the regulation for international aid and relief • Add the regulation for the rights and obligations of ... frequent natural disaster damage 1.1 There have been a variety of disasters occurred in Vietnam, categorizing by regions and specific geographical areas: a) Disasters occurred in specific regions:...
- 20
- 330
- 0
Báo cáo y học: " Differential effects of cigarette smoke on oxidative stress and proinflammatory cytokine release in primary human airway epithelial cells and in a variety of transformed alveolar epithelial cells" potx
... evidence of apoptosis in primary human small airway epithelial cells (SAEC) Primary human small airway epithelial cells (SAEC) were treated with media alone (control) and various concentrations of ... effects of cigarette smoke on oxidative stress and proinflammatory cytokine release in primary human airway epithelial cells and in a variety of transformed alveolar epithelial cells Respir Res 2006, ... chromatin condensation, whereas necrotic or late apoptotic cells had normal/condensed nuclei that were brightly stained with ethidium bromide and appeared red Percentage of viable (white bars), apoptotic...
- 3
- 307
- 0
Báo cáo y học: " Differential effects of cigarette smoke on oxidative stress and proinflammatory cytokine release in primary human airway epithelial cells and in a variety of transformed alveolar epithelial cells" pps
... in primary human small airway epithelial cells (SAEC) Primary human small airway epithelial cells (SAEC) were treated with media alone (control) and various concentrations of CSE; a) control, ... changes, such as cell shrinkage, condensation and fragmentation of nuclear material Necrosis on the other hand, is a passive response characterized by cytoplasmic swelling, rapid loss of plasma ... as a therapeutic strategy Pharmacol Ther 2006, 111:476-494 Rahman I, Biswas SK, Kode A: Oxidant and antioxidant balance in the airways and airway diseases Eur J Pharmacol 2006, 533:222-239 Marwick...
- 20
- 478
- 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 4169–4183 ª 2009 The ... for examining the consequence of mutations that may affect substrate binding and catalysis Using a database of 380 unique TIM sequences from non-archaeal sources, we have examined the nature of ... monitoring the decrease in absorbance of NADH at 340 nm The dependence of the initial rate on the substrate concentration was analyzed according to the Michaelis– Menten equation (Eqn 1) as follows:...
- 15
- 635
- 0
Tài liệu Báo cáo khoa học: Modeling of tRNA-assisted mechanism of Arg activation based on a structure of Arg-tRNA synthetase, tRNA, and an ATP analog (ANP) ppt
... form aminoacyl-tRNA In the aminoacylation reaction of class I aaRSs with aminoacyl-AMP, the 2¢-OH group of the ribose of A7 6 tRNA attacks the carbonyl carbon atom of the –Ca–(CO)–O– moiety of aminoacyl-AMP ... aminoacylation reaction, the kcat and Km values for tRNAArgICG and tRNAArgUCU on the Asn106 fi Ala, Phe109 fi Ala and Gln111 fi Ala mutant proteins of S cerevisiae ArgRS are the same as those on the ... conformation that is fit to activate The fact that kcat and Km for tRNAArg in the aminoacylation reaction not change in the Asn106 fi Ala, Gln111 fi Ala and Phe109 fi Ala mutants of S cerevisiae ArgRS...
- 17
- 512
- 0
Đề tài " On a class of type II1 factors with Betti numbers invariants " pdf
... Section we define the class HT of factors M having HT Cartan subalgebras A ⊂ M , i.e., maximal abelian ∗ -subalgebras A ⊂ M such that M has the property H relative to A and A contains a subalgebra ... maps; then we recall the basic construction of an inclusion of finite von Neumann algebras and study their compact ideal space; we also recall the definitions of normalizer and quasinormalizer of ... most one such maximal abelian ∗ -subalgebra A ⊂ M , up to unitary conjugacy Moreover, we prove that if A ⊂ M satisfies these conditions then A is automatically a Cartan subalgebra of M , i.e., the...
- 92
- 436
- 0
Báo cáo hóa học: " Properties of nanocones formed on a surface of semiconductors by laser radiation: quantum confinement effect of electrons, phonons, and excitons" pptx
... formation of nanocones on the irradiated surface of a semiconductor by selective laser heating of the top layer with following mechanical plastic deformation of the layer as a result of relaxation of ... excitons, phonons, etc.) in nanocone is a special case, since diameter of nanocone is a monotonous function of height, leading to gradual change of bandgap Graded bandgap structure has an effect on ... experiment All of the authors participated to the analysis of the data and wrote the article AMy carried out the sample preparation, the measurements for solid solutions of CdZnTe PO carried out the sample...
- 6
- 489
- 0
Báo cáo hóa học: " On a class of second-order nonlinear difference equation" potx
... ¯ nontrivial If the solution is a nontrivial solution, then we can further divide the solution into two cases: non-oscillatory solution and oscillatory solution A nontrivial solution {xn }∞ of ... authors carried out the proof All authors conceived of the study and participated in its design and coordination All authors read and approved the final manuscript Competing interests The authors ... Difference Equations, with Open Problems and Conjectures Chapman and Hall/CRC, London (2002) xn−1 Amleh, AM, Georgia, DA, Grove, EA, Ladas, G: On the recursive sequence xn+1 = α + x J Math Anal Appl...
- 9
- 562
- 0
Báo cáo hóa học: " Letter to the Editor Remarks on “On a Converse of Jensen’s Discrete Inequality” of S. Simic ´" doc
... functionals A : L → A1 A af bg aA f bA g A2 if f ∈ L, f t ≥ for all t ∈ E, then A f ≥ positivity If in addition A 1 is satisfied, then we say that A is a positive normalized linear functional Peˇ ari´ ... introduce the concept of positive linear functionals defined on a linear class of real-valued functions Let E be a nonempty set, and let L be a linear class of functions f : E → Ê having the following ... Iveli´ and Peˇ ari´ obtained generalizations of Theorem for convex functions c c c defined on convex hulls Remark The general results for concave functions can be proved in an analogous way, that...
- 4
- 265
- 0
Báo cáo hóa học: " Research Article On a Converse of Jensen’s Discrete Inequality" doc
... related to the first part of Theorem 2.1 Proofs concerning concave functions go along the same lines Proof of Theorem 2.1 We apply the method already shown in Namely, since a ≤ xi ≤ b, there is a sequence ... equal to Er,2r Example 4.1 Taking f x 1/x, after an easy calculation it follows that S1/x a, b G a, b Therefore we consequently obtain the result A a, b / Journal of Inequalities and Applications ... 2, article 60, pages, 2009 G Polya and G Szego, Aufgaben und Lehrsatze aus der Analysis, Springer, Berlin, Germany, 1964 K B Stolarsky, “Generalizations of the logarithmic mean,” Mathematics Magazine,...
- 6
- 302
- 0
Báo cáo hóa học: " Research Article On a Class of Parametric Transforms and Its Application to Image Compression" ppt
... Ω, the families of Hadamard-like and Haar-like transforms, which are of a particular interest since they are generalizations of the classical Hadamard and Haar transforms Definition Within the ... presented on Figure 12 allows also automatic generation of transform parameters meaning that the transform may automatically be adapted to the input signal or image CONCLUSION A new class of parametric ... 2: The fast Hadamard-like transform of order N = 11 Figure 3: The fast Haar-like transform of order N = 11 The classical Hadamard transform belongs to the family Ω of Hadamard-like transforms and...
- 14
- 484
- 0
ON A CLASS OF FOURTH-ORDER NONLINEAR DIFFERENCE EQUATIONS MAŁGORZATA MIGDA, ANNA MUSIELAK, AND EWA pptx
... constant β such that yn /Qn,N → β According to Lemma 2.5, we may regard an asymptotically constant solution as a “minimal” solution, and an asymptotically Qn,N solution as a “maximal” solution ... derive a necessary and sufficient condition for the existence of an asymptotically constant solution of (1.1) Theorem 2.8 Assume that (H1), (H2), and (H3) hold and the function f is a monotonic function ... present a necessary and sufficient condition for the existence of an asymptotically Qn,N solution Theorem 2.6 Assume that (H1), (H2), and (H3) hold and f is a nondecreasing function in another argument,...
- 14
- 274
- 0
QUANTUM DOTS – A VARIETY OF NEW APPLICATIONS pdf
... explained only by the presence of InAs layer on the epitaxial surface This means that the decrease of signal intensity {3} is not caused only by the increase of As atom concentration on the epitaxial ... layers The lattice constant of the strain reducing material is bigger than that for GaAs substrate but smaller than lattice constant of the dot material (InAs or InGaAs) The redshift is then caused ... effect of reduced strain inside quantum dots, increased dot aspect ratio and decreased bandgap of the capping barrier material Materials most often used for the strain reduction are InGaAs and GaAsSb...
- 290
- 497
- 0
Word Grammar New Perspectives on a Theory of Language Structure. docx
... Grammar Surface Structures and HPSG Order Domains Takafumi Maekawa Introduction A Word Grammar Approach An Approach in Constructional HPSG: Ginzburg and Sag 2000 A Linearization HPSG Approach ... its heart, and networks also loomed large at tihat time in the Stratificational Grammar of Lamb (1966; Bennett 1994) Another reason why stratificational grammar was important was that it aimed ... Thus the fact that the past tense of COME is came automatically blocks the inheritance of the default pattern for past tense verbs One of the advantages of a network notation is that this is easy...
- 251
- 554
- 0
Báo cáo toán học: "On a System of Semilinear Elliptic Equations on an Unbounded Domain" potx
... C Vargas and M Zuluaga, On a Nonlinear Dirichlet Problem Type at Resonance and Bifurcation, Partial Differential Equations, Pitman Research Notes in Math., Series 273, 1992 M Zuluaga, On a nonlinear ... continum of foliated solution for a quasilinear elliptic equation with a non Lipschitz nonlinearity, Commun In Partial Diff Equation 17 (1992) L C Evans, Partial Diff Equations, American Math Society, ... Hoang Quoc Toan 382 The aim of this paper is to study the existence of weak solution of the problem (1.1)-(1.2) under hypothesis (1.3), (1.4) and suitable conditions for the parameters...
- 9
- 246
- 0
Báo cáo toán học: "On a Class of Constant Weight Codes" pptx
... of a normalized Hadamard matrix of order 4t, the set of all the rows of the remaining matrix can be seen (by replacing each occurrence of a −1 with 0) as a nonlinear code of length n = 4t − having ... multiplicative character of a finite field on a coset of a certain subfield See, for example, [3] In the third section of the paper we provide an extension of the basic construction, the result of which ... in statistics In the fourth section of the paper we shall prove the ‘quasi-random’ character [4] of the distribution of the 0’s and 1’s in the codewords of the constructed binary codes, by making...
- 13
- 348
- 0
Báo cáo toán học: "On a theorem of Erd˝s, Rubin, and Taylor on o choosability of complete bipartite graphs" pptx
... Rubin, and Taylor) o A vertex t-coloring of a hypergraph H is panchromatic if each of the t colors is used on every edge of G Thus, an ordinary 2-coloring is panchromatic Some results on the existence ... that the lower bound on p(r, k) with c1 = 1/4 follows also from Theorem of the seminal paper [5] by Erd˝s and Lov´sz o a We say that a k-uniform hypergraph G is k-partite, if V (G) can be partitioned ... Theorem can be extended in a natural way in two directions: to complete k-partite graphs and to k-uniform k-partite hypergraphs In this note we present these extensions (using the ideas of...
- 4
- 255
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu