handouts with three slides per page by choosing a new option from the print what box by clicking on the drop down arrow

Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx

Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx

Ngày tải lên : 23/03/2014, 21:20
... Similar aggregates appeared only very faintly in the absence of lipids (Fig 4A) The rather long lag phase preceding fast hemolysis (Fig 1A) may also indicate that the formation of a functional ... with the 90 polarizer, and S are order parameters calculated from the ratio of the parallel and perpendicular absorption bands SL is for the lipid chains, derived from the symmetric and asymmetric ... ultracentrifuged and the sediments and supernatants obtained were analyzed (A) lane 1, Pharmacia low molecular mass standards; lane 2, ostreolysin (noncentrifuged); lane 3, ostreolysin (supernatant); lane...
  • 12
  • 492
  • 0
báo cáo khoa học: "Superior canal dehiscence in a patient with three failed stapedectomy operations for otosclerosis: a case report" pps

báo cáo khoa học: "Superior canal dehiscence in a patient with three failed stapedectomy operations for otosclerosis: a case report" pps

Ngày tải lên : 11/08/2014, 00:22
... JE analyzed and interpreted the patient data regarding the otorhinolaryngological disease TU and HS were major contributors in writing the manuscript All authors read and approved the final manuscript ... oscillopsia may require surgical treatment The standard surgical options include middle fossa craniotomy for superior canal occlusion or resurfacing and transmastoid superior semicircular canal occlusion ... that the SCD can cause CHL is demonstrated by resolution of the air-bone gap upon patching or plugging the dehiscence, as reported by various investigators [10,14] The mechanism of CHL in a patient...
  • 3
  • 264
  • 0
Tài liệu Choosing A New Career Path ppt

Tài liệu Choosing A New Career Path ppt

Ngày tải lên : 22/12/2013, 02:17
... and wanted more information The librarian directed her to various reference guides and books on careers, most notably the Occupational Outlook Handbook The Occupational Outlook Handbook gave her ... information regarding what the different jobs entailed, what the work environments were like, what criteria she needed to meet for employment, and what kind of salary ranges she could expect As ... located other positions that were more appealing to her than she would have imagined from the job titles alone, so she added those to her list As her list grew, she again paid particular attention...
  • 3
  • 354
  • 1
Choosing a New Organization for Management and Disposition of Commercial and Defense High-Level Radioactive Materials ppt

Choosing a New Organization for Management and Disposition of Commercial and Defense High-Level Radioactive Materials ppt

Ngày tải lên : 23/03/2014, 00:20
... dedicated funding stream but is subject to an annual appropriation, and Amtrak (a GOVCORP) has both dedicated funding streams and annual appropriations NASA (an IGA) receives annual appropriations ... Alternative Means of Financing and Managing Radioactive Waste Facilities (known as AMFM) analyzed ten organizational alternatives and recommended the creation of a federal corporation for waste management ... MDO management and disposition organization MDWG Management and Disposition Working Group MRS monitored retrievable storage NASA National Aeronautics and Space Administration NGO nongovernmental...
  • 132
  • 357
  • 0
Báo cáo khoa học: Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel specificity towards C-terminal glutamate residues pptx

Báo cáo khoa học: Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel specificity towards C-terminal glutamate residues pptx

Ngày tải lên : 23/03/2014, 12:20
... When the carboxypeptidase activity (FAEE substrate) of the mixture was assayed, there was a qualitative correlation between the appearance of the putative 36 kDa activated carboxypeptidase polypeptide, ... Isolation and characterization of cDNAs encoding H armigera carboxypeptidase The construction of a cDNA library in the phage k vector Lambda Uni-ZAP XR (Stratagene) from RNA extracted from gut ... Characterization of H armigera carboxypeptidaseencoding cDNAs cDNAs encoding the 35 kDa H armigera carboxypeptidase (band C, Fig 1A) are exemplified by a clone designated HaCA42 This cDNA (accession no AJ626862)...
  • 12
  • 458
  • 0
Báo cáo khoa học: NMR solution structure of Cn12, a novel peptide from the Mexican scorpion Centruroides noxius with a typical b-toxin sequence but with a-like physiological activity doc

Báo cáo khoa học: NMR solution structure of Cn12, a novel peptide from the Mexican scorpion Centruroides noxius with a typical b-toxin sequence but with a-like physiological activity doc

Ngày tải lên : 23/03/2014, 12:20
... were added to the calculations The dynamic annealing structure calculations were performed with the CNS software suite [44] Analysis of Na+-channel sequences By searching data banks containing ... using the same conditions as reported [34] Determination of amino-acid sequence and MS analysis The full amino-acid sequence of the toxin was obtained by direct Edman degradation, using an automatic ... voltagedependent activation and steady-state inactivation (n ¼ 4; Materials and methods) The Boltzmann relationships (dashed lines) were fitted with the following parameters (mV): activation (control)...
  • 13
  • 434
  • 0
Báo cáo Y học: Modeling the three-dimensional structure of H+-ATPase of Neurospora crassa Proposal for a proton pathway from the analysis of internal cavities pptx

Báo cáo Y học: Modeling the three-dimensional structure of H+-ATPase of Neurospora crassa Proposal for a proton pathway from the analysis of internal cavities pptx

Ngày tải lên : 23/03/2014, 21:20
... The horizontal black lines delineate the approximate membrane position The catalytic Asp (Asp378) appears in red defective in the E1-E2 conformational change Here, the Val336Ala mutant displayed ... phosphorylated aspartate (Asp378 in PMA1_NEUCR), several cavities are also seen at the same position in ATC1_RABIT (data not shown) Aside from mutations directed against a small stretch of amino acids ... Val334, and Val336 on M4 and Ala726 and Asp730 on M6 Alanine-scanning mutagenesis along segment M4 of yeast H+-ATPase showed that replacement of Ile331 and Val334 had little or no effect on ATP-dependent...
  • 13
  • 514
  • 0
Báo cáo y học: "(Sub)clinical cardiovascular disease is associated with increased bone loss and fracture risk; a systematic review of the association between cardiovascular disease and osteoporosis" ppsx

Báo cáo y học: "(Sub)clinical cardiovascular disease is associated with increased bone loss and fracture risk; a systematic review of the association between cardiovascular disease and osteoporosis" ppsx

Ngày tải lên : 12/08/2014, 15:22
... Research Institute/Reade, Dr Jan van Breemenstraat 2, 1056 AB Amsterdam, The Netherlands Authors’ contributions DU conducted the data collection, interpretation and analysis of the data and drafted ... postmenopausal women with osteoporosis Maturitas 2006, 55:212-218 61 Sumino H, Ichikawa S, Kasama S, Takahashi T, Sakamoto H, Kumakura H, Takayama Y, Kanda T, Murakami M, Kurabayashi M: Relationship ... Mani A, Radhakrishnan J, Wang H, Mani A, Mani MA, Nelson-Williams C, Carew KS, Mane S, Najmabadi H, Wu D, Lifton RP: LRP6 mutation in a family with early coronary disease and metabolic risk factors...
  • 19
  • 500
  • 0
Estimation of uncertainty in three dimensional coordinate measurement by comparison with calibrated points ppt

Estimation of uncertainty in three dimensional coordinate measurement by comparison with calibrated points ppt

Ngày tải lên : 20/06/2014, 18:20
... Calibration The LVDT is calibrated with a magnification standard At our normal magnification for roundness calibrations the magnification standard uncertainty is approximately 0.10 ␮m over a ... of Thermal Expansion The variation in the CTE for similar gage block materials is generally smaller than the Ϯ1ϫ10 –6 /ЊC allowed by the ISO and ANSI gage block standards From the variation of ... corrections are nearly the same There is a small correction because in one case the contact is a probe ball against a plane and in the ring case the ball probe is against a cylinder These corrections,...
  • 30
  • 473
  • 0
báo cáo khoa học: " Identification of three wheat globulin genes by screening a Triticum aestivum BAC genomic library with cDNA from a diabetes-associated globulin" doc

báo cáo khoa học: " Identification of three wheat globulin genes by screening a Triticum aestivum BAC genomic library with cDNA from a diabetes-associated globulin" doc

Ngày tải lên : 12/08/2014, 03:20
... coverage and has been gridded onto 24 high-density filters [42] A 459 bp probe (amplified using primers 5'AAAAAGCAGGCTTTCGACGAAGTGTCCAGG 3'and 5'AGAAAGCTGGGTTGCCCAAGAGACTACCCA 3') for the BAC library ... edited the manuscript IA designed the study, contributed to data analysis, and edited the manuscript All authors read and approved the final manuscript Additional material Additional file Putative ... genome), and Ae tauschii (DD genome) A 650 bp fragment, amplified from the highly conserved region among all of the three BAC clones was used as a hybridization probe All of the cultivars examined contained...
  • 11
  • 303
  • 0
Báo cáo y học: "The appropriateness of single page of activation of the cardiac catheterization laboratory by emergency physician for patients with suspected ST-segment elevation myocardial infarction: a cohort study" doc

Báo cáo y học: "The appropriateness of single page of activation of the cardiac catheterization laboratory by emergency physician for patients with suspected ST-segment elevation myocardial infarction: a cohort study" doc

Ngày tải lên : 13/08/2014, 23:20
... significant coronary artery disease and negative cardiac biomarkers A culprit coronary artery was defined as the presence of an acute total or subtotal occlusion of a coronary artery or a coronary ... Vetrovec GW: An evaluation of the accuracy of emergency physician activation of the cardiac catheterization laboratory for patients with suspected ST-segment elevation myocardial infarction Ann Emerg ... Pearle DL, Sloan MA, Smith SC Jr, American College of Cardiology, American Heart Association, Canadian Cardiovascular Society: ACC/AHA guidelines for the management of patients with ST-elevation...
  • 6
  • 232
  • 0
Tài liệu Báo cáo khoa học: Insights into the interaction of human arginase II with substrate and manganese ions by site-directed mutagenesis and kinetic studies Alteration of substrate specificity by replacement of Asn149 with Asp docx

Tài liệu Báo cáo khoa học: Insights into the interaction of human arginase II with substrate and manganese ions by site-directed mutagenesis and kinetic studies Alteration of substrate specificity by replacement of Asn149 with Asp docx

Ngày tải lên : 20/02/2014, 02:21
... arginase activity of the Asn149Asp variant was practically undetectable, both before and after the incubation with the manganese ions Fully active His120Asn and His145Asn variants exhibited about ... Interaction of arginase II with substrate and manganese ions ˚ separation of 2.6 A was considered to be somewhat long for an inner-sphere coordination interaction, as that observed in arginase ... discrimination is particularly important for mammalian arginase II and agmatinase, as both enzymes are mitochondrial and functionally different [22] A key factor is the a- carboxyl group of the substrate, which...
  • 9
  • 651
  • 0
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

Ngày tải lên : 20/02/2014, 02:21
... in the rate of interaction with factor Xa brought about by the heparin pentasaccharide-mediated conformational change occurs through a combination of the changes in the structure of the RCL, allowing ... plasma concentration of AT and the rates of interaction in the presence and absence of heparin pentasaccharide (Table 1), one can calculate that the half-life of enzyme activity in the absence ... coagulation enzymes, such as thrombin, indicating that the conformational change in AT alone does not cause much acceleration in the rate of interaction [15] For full acceleration of the rate...
  • 10
  • 668
  • 0
Tài liệu Báo cáo khoa học: "Three BioNLP Tools Powered by a Biological Lexicon" doc

Tài liệu Báo cáo khoa học: "Three BioNLP Tools Powered by a Biological Lexicon" doc

Ngày tải lên : 22/02/2014, 02:20
... show the percentage of the terminological words and derivational relations (such as the word retroregulate and the derivational relation retroregulate → retroregulation) in our lexicon that are also ... Rebholz-Schuhmann, Piotr Pezik, Vivian Lee, Jung-Jae Kim, Riccardo del Gratta, Yutaka Sasaki, Jock McNaught, Simonetta Montemagni, Monica Monachini, Nicoletta Calzolari, Sophia Ananiadou, BioLexicon: Towards ... retro-regulate This means that derivational relations of retro-regulate are not covered by the Specialist Lexicon 20 adverbal adjetivial Terminologies nominalization adverb adjective noun verb Derivational...
  • 4
  • 334
  • 0
BIRD STORIES FROM BURROUGHS SKETCHES OF BIRD LIFE TAKEN FROM THE WORKS OF JOHN BURROUGHS WITH ILLUSTRATIONS BY LOUIS AGASSIZ FUERTES doc

BIRD STORIES FROM BURROUGHS SKETCHES OF BIRD LIFE TAKEN FROM THE WORKS OF JOHN BURROUGHS WITH ILLUSTRATIONS BY LOUIS AGASSIZ FUERTES doc

Ngày tải lên : 06/03/2014, 13:20
... such an apparent stomachic contraction This bird is the only feathered polygamist we have The females are greatly in excess of the males, and the latter are usually attended by three or four of the ... could approach, and no concealment anywhere The nest was a hasty affair, as if the birds' patience at nest-building had been about exhausted Presently an egg appeared, and then the next day another, ... position as before, stood upon it again for a moment, and then flew away Again the paper left the branch, and sailed away slowly to the ground The bird seized it again, jerking it about rather...
  • 112
  • 421
  • 0
Báo cáo khoa học: Two L-amino acid oxidase isoenzymes from Russell’s viper (Daboia russelli russelli) venom with different mechanisms of inhibition by substrate analogs pdf

Báo cáo khoa học: Two L-amino acid oxidase isoenzymes from Russell’s viper (Daboia russelli russelli) venom with different mechanisms of inhibition by substrate analogs pdf

Ngày tải lên : 07/03/2014, 05:20
... OAB became saturated The initial appearance and subsequent disappearance of the slope effect with increasing concentrations of OAB as I2 is consistent with the sequential saturation of the three ... Gowda TV (1989) Purication and characterization of a major phospholipase A2 from Russells viper (Vipera russelli) venom Toxicon 27, 229237 30 Tokunaga F, Nagasawa K, Tamura S, Miyata T, Iwanaga ... N-acetyltryptophan (NAT) bears a carboxylate group that is free for interaction The importance of the amino and carboxylate groups could only be assessed with substrate analogs that not have the a- CH in...
  • 18
  • 306
  • 0
Báo cáo khoa học: Molecular basis of perinatal hypophosphatasia with tissue-nonspecific alkaline phosphatase bearing a conservative replacement of valine by alanine at position 406 Structural importance of the crown domain potx

Báo cáo khoa học: Molecular basis of perinatal hypophosphatasia with tissue-nonspecific alkaline phosphatase bearing a conservative replacement of valine by alanine at position 406 Structural importance of the crown domain potx

Ngày tải lên : 07/03/2014, 05:20
... hypophosphatasia, (b) infantile hypophosphatasia, (c) childhood hypophosphatasia, (d) adult hypophosphatasia and (e) odonto hypophosphatasia [1–4] Perinatal and infantile forms of hypophosphatasia are ... Molecular basis of perinatal form of hypophosphatasia N Numa et al the valine residue at position 406 on one subunit may interact with the counterpart on the other subunit through their long aliphatic ... hypophosphatasia Eur J Med Genet 50, 367–378 Cai G, Michigami T, Yamamoto T, Yasui N, Stomura K, Yamagata M, Shima M, Nakajima S, Mushiake S, Okada S et al (1998) Analysis of localization of mutated...
  • 11
  • 500
  • 0
MY REMINISCENCES BY SIR RABINDRANATH TAGORE WITH FRONTISPIECE FROM THE PORTRAIT IN COLORS doc

MY REMINISCENCES BY SIR RABINDRANATH TAGORE WITH FRONTISPIECE FROM THE PORTRAIT IN COLORS doc

Ngày tải lên : 29/03/2014, 11:20
... the Ramayana of Krittivasa A picture of one day's reading of the Ramayana comes clearly back to me RABINDRANATH TAGORE IN 1877 The day was a cloudy one I was playing7 about in the long verandah[3] ... he a foreigner, but a Panjabi to boot,— what wonder he stole our hearts away? We had the same reverence for the whole Panjabi nation as for Bhima and Arjuna of the Mahabharata They were warriors; ... had accompanied my father on a trip on the Ganges in his houseboat Among the books he had with him was an old Fort William edition of Jayadeva's Gita Govinda It was in the Bengali character The...
  • 171
  • 307
  • 0
Digital design with CPLD applications and VHDL by dueck

Digital design with CPLD applications and VHDL by dueck

Ngày tải lên : 01/04/2014, 17:47
... that they are out of phase Compare the enable/inhibit waveforms of the AND, OR, NAND, and NOR gates Gates of the same shape are enabled by the same Control level AND and NAND gates are enabled by ... Boolean algebra that allow us to transform any gate from an AND-shaped to an OR-shaped gate and vice versa DeMorgan equivalent forms Two gate symbols, one AND-shaped and one ORshaped, that are ... True/False Boolean algebra A system of algebra that operates on Boolean variables The binary (two-state) nature of Boolean algebra makes it useful for analysis, simplification, and design of combinational...
  • 841
  • 540
  • 3