gt a5 mutation is inhibited in the presence of a3g and d128k a3g but not a3f
Báo cáo y học: " Human endogenous retrovirus HERV-K(HML-2) encodes a stable signal peptide with biological properties distinct from Rec" pps
Ngày tải lên :
13/08/2014, 05:21
... being incubated at 37°C for another hours in the presence of 100 μg/ml CHX Finally, cells were fixed for immunostaining as described above Human and mouse nuclei were distinguished by staining ... orientation of SPs across the ER membrane defines two types of signal peptides Type I SPs anchor the proteins by transferring it across the ER membrane, leaving the C-terminus of the protein in the cytoplasmic ... nucleoli resulting in a subcellular distribution similar, but not identical, to that of Rec The full-length SP fusion protein, SP96-RFP, displayed an unexpected phenotype In about half of the transfected...
- 20
- 250
- 0
Báo cáo khoa hoc:" Comparison of nanoparticle-mediated transfection methods for DNA expression plasmids: efficiency and cytotoxicity" potx
Ngày tải lên :
11/08/2014, 08:20
... Clinic and the Equine Clinic, participated in the conception design of the study HME carried out the principal study design, partial drafting and finalisation of the manuscript and the supervision ... transfection, the expression of simple proteins as GFP and the nuclear acting HMGB1 and of complex proteins consisting of two separate subunits as IL-12 is possible Furthermore, the addition of NP or ... transfections, the fluorescence and immunofluorescence microscopy analysis, the statistical analysis and the partial drafting of the manuscript SW participated in the expression vector design and construction,...
- 11
- 376
- 0
Báo cáo y học: " Proviral integrations and expression of endogenous Avian leucosis virus during long term selection for high and low body weight in two chicken lines" ppt
Ngày tải lên :
12/08/2014, 23:21
... such as in the LWS line may affect the growth indirectly The activation of inflammatory cytokines such as the interferon-gamma, TNF-alpha, interleukin-1 and -6, their receptors and signalling pathway ... differences in ALVE integration between the LWS and HWS lines indicated by the large difference in expression may be related to the establishment of the extreme phenotypes of these selected lines Periodic ... 5.56 ± 0.46 and RJ = 3.59 ± 0.56 N = 82 in F9 birds and n = 10 in the other populations F9, generation of the advanced intercross line; H41 and L41, generation 41 of the HWS and LWS lines, respectively;...
- 13
- 284
- 0
Reagents and instrumentation
Ngày tải lên :
25/10/2013, 22:20
... matched to the template is the 3′-end because this is the end of the primer that is extended by the DNA polymerase and is therefore most important for ensuring the specificity of annealing to the correct ... (Invitrogen) The proofreading ability is due to the capacity of the enzyme to discriminate between whether the nucleotide at the 3′-OH of an extending strand is correctly or incorrectly paired with the ... the 3′-end of the new DNA strand This results in a single overhanging base that can affect the efficiency of a variety of subsequent manipulations, including cloning and mutagenesis Proofreading...
- 42
- 294
- 0
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
Ngày tải lên :
12/02/2014, 10:20
... ampicillin and IPTG concentrations, temperature and time of induction were tested The growth and induction conditions of PI-17 giving maximal yield of the recombinant fusion protein established ... Mr of the obtained recombinant fusion protein should be about 58 kD ( the sum of 55 + 3.4kD of MCoTI-II) As seen on Fig 10 the 58 kD protein band was found in induced sample as the major band, ... restricsion site was introduced on the end, stop codon and Xho I restriction site was introduced on the end of the proposed synthetic trypsin inhibitor gene The sequences of the forward and reversed...
- 9
- 497
- 0
Tài liệu Báo cáo khoa học: Restricted localization of proline-rich membrane anchor (PRiMA) of globular form acetylcholinesterase at the neuromuscular junctions – contribution and expression from motor neurons doc
Ngày tải lên :
18/02/2014, 08:20
... reduction of G1 and G4 forms in the spinal cord and of G1, G4 and A12 forms in the tibialis (Fig 8C) Thus, denervation induced a decrease in PRiMA and G4 AChE in the spinal cord and muscle To investigate ... birth, but increased dramatically thereafter and was the predominant form in the adult, the PRiMA II transcript first increased but disappeared in the adult (Fig 5A) As a result of the absence of ... (Fig 5E) To determine the origin of AChE in the spinal cord, the lumbar region of the spinal cord was sectioned and stained with the PRiMA antibody The label was mostly present in the ventral horn...
- 12
- 488
- 0
Tài liệu Báo cáo khoa học: Nuclear receptors in the mosquito Aedes aegypti Annotation, hormonal regulation and expression profiling ppt
Ngày tải lên :
18/02/2014, 13:20
... of the human orthologs When different isoforms were recovered, only the longest amino acid sequences that included the DNA binding, hinge and ligand-binding domains were used for this analysis, ... typical members of the NR family, differing only in the N-terminal end of the variable A ⁄ B domain The third mosquito isoform, AaHNF-4C, lacks the greater part of this A ⁄ B domain and the complete ... blocked The presence of 20E, however, favors the formation of the AaEcR ⁄ AaUSP heterodimer [13], indicating that the regulation of the activity of these proteins occurs through protein–protein interactions,...
- 22
- 578
- 0
Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx
Ngày tải lên :
20/02/2014, 02:21
... kidney and liver Data are presented as PCR products after normalizing against products of b-actin The x-axis indicates the time-periods of LPS incubation and the relative expression of the carp ... from the lethal effects of endotoxin challenge and reduces the levels of TNF, IFN-c and macrophage in ammatory protein-2 [36] Although the expression study indicates that this cytokine is involved ... torafugu and human The x-axis denotes the residue position and the y-axis represents hydrophobicity The hydrophobicity analysis was carried out according to the Kyte and Doolittle method [22] using...
- 8
- 584
- 0
Tài liệu Báo cáo Y học: Purification, characterization, cloning, and expression of the chicken liver ecto-ATP-diphosphohydrolase pot
Ngày tải lên :
22/02/2014, 04:20
... on the right side of the figure The transmembranous domains of the protein at the N- and C-terminus are shaded The five apyrase conserved regions (ACRs) are underlined and in bold The 10 cysteine ... staining [33–36] Besides oviduct and liver, the chicken ectoATPDase is also present in the apical membranes of the oxyntic-peptic cells [37] The distribution of the ectoATPDase on these epithelial ... hydrolysis at pH 7.4 (h) and 6.4 (j) inhibition by azide was of the mixed and uncompetitive type [31] The mechanism of inhibition of fluoride and vanadate has not been investigated, but they are...
- 10
- 694
- 0
Report of the Special Rapporteur on the promotion and protection of the right to freedom of opinion and expression, Frank La Rue* ppt
Ngày tải lên :
06/03/2014, 21:20
... and impart information and ideas of all kinds, regardless of frontiers, either orally, in writing or in print, in the form of art, or through any other media of his choice; (c) The exercise of ... guarantees of the right to privacy and protection of personal data, which inhibit the dissemination of opinions and information The Special Rapporteur is of the view that the arbitrary use of criminal ... by intermediaries, and there is a worrying trend of States obliging or pressuring these private actors to hand over information of their users Moreover, with the increasing use of cloud-computing...
- 22
- 400
- 0
The CMU Pose, Illumination, and Expression (PIE) Database potx
Ngày tải lên :
07/03/2014, 14:20
... partitions, the first consisting of the pose and illumination variation, the second consisting of the pose and expression variation Since the major novelty of the PIE database is the pose variation, ... extra benefit of the filtering is that the flashes are then substantially less bright than when not filtered There are therefore no cases of the subjects either blinking or grimacing during the capture ... Examples of the pose and illumination variation are shown in Figures and Figure contains the variation with the room lights on and Figure with the lights off Comparing the images we see that those in...
- 6
- 343
- 0
Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf
Ngày tải lên :
07/03/2014, 16:20
... on the gastrointestinal epithelium, IL-11 has a profound activity in the protection and restoration of the gastrointestinal mucosa [13,14] Interestingly IL-11 stimulates osteoclast formation and ... sequence is relaced by ‘|’ and insertions indicated by ‘-’ The two insertions in the 5¢- and 3¢-UTR are underlined and the 13 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the ... the 3¢-UTR are numbered and distinguished from each other by alternate highlighting in bold and italics The ATTTA motifs in the 5¢- and 3¢-UTRs, the start and stop codons, the signal peptide predicted...
- 12
- 511
- 0
Báo cáo Y học: Cloning and expression of sterol D14-reductase from bovine liver potx
Ngày tải lên :
08/03/2014, 16:20
... in control cells These results are consistent with the known subcellular localization of the enzymes involved in cholesterol biosynthesis and with the puri®cation of the bovine protein from the ... mechanisms of the D14-SR gene expression and its possible role in the metabolism of meiosis activating sterols Mutation analysis of TM7SF2 will clarify whether a defect in this gene underlies the ... bovine D14-SR, regions of the deduced amino-acid sequence corresponding to the N-terminal and V8 peptide sequences determined in the sequencing experiments of the protein puri®ed from bovine...
- 8
- 493
- 0
Báo cáo khoa học: Identification and expression of the first nonmammalian amyloid-b precursor-like protein APLP2 in the amphibian Xenopus laevis ppt
Ngày tải lên :
16/03/2014, 16:20
... structural features not present in the other members of the APP superfamily, such as the absence of the exon encoding the KPI domain and the lack of a second heparin-binding domain [3,4,13,26] Comparative ... proteins are 91% and 100% identical, respectively, including the GYENPTY sequence that is present in all APP superfamily members and is involved in the intracellular routing of the proteins [17] ... indicates the absence of exon In all of the Xenopus tissues examined, mRNA forms that were lacking exon were present In intestine and stomach, and to a lesser extent in brain, liver and lung,...
- 7
- 405
- 0
Báo cáo khoa học: Identification and expression analysis of an IL-18 homologue and its alternatively spliced form in rainbow trout (Oncorhynchus mykiss) doc
Ngày tải lên :
16/03/2014, 16:20
... splicing of the IL-18 gene in rainbow trout (A) An alternative mRNA splicing site is present in exon of the trout IL-18 gene Arrows indicate the splicing sites and the boxed letters represent the ... Japanese pufferfish [9] All of these studies, together with the finding of the trout IL-18 in the present study, suggest the existence of the IFN-c homologue in fish and perhaps a similar Th1-like ... Cloning and expression of interleukin-18 binding protein FEBS Lett 445, 338–342 32 Novick, D., Kim, S.H., Fantuzzi, G., Reznikov, L.L., Dinarello, C.A & Rubinstein, M (1999) Interleukin-18 binding...
- 11
- 426
- 0
Báo cáo khoa học: Cloning and expression of a tomato cDNA encoding a methyl jasmonate cleaving esterase pdf
Ngày tải lên :
16/03/2014, 18:20
... To date there is no way of distinguishing between the function of the two compounds on a physiological basis as they can be rapidly converted from one into the other For the Arabidopsis jar1 ... response against feeding Colorado potato beetle is not limited to the site of their attack, but also appears in distant leaves of the plant [15] The herbivore attack induces JA biosynthesis locally ... substantiates that the cloned cDNA encodes the purified protein The calculated molecular mass of the encoded protein is 29 524.93 Da and the pI ¼ 5.52 The calculated mass of the encoded protein corresponds...
- 8
- 458
- 1
Báo cáo khoa học: "Sentence and Expression Level Annotation of Opinions in User-Generated Discourse" potx
Ngày tải lên :
16/03/2014, 23:20
... two types of opinions, sentiment and arguing It annotates the opinion expression and target spans The link and link type attributes associate the target with other targets in the discourse through ... fact=yes If the sentence is a polar fact, then the aim is to mark the target and label the polarity of the evaluation If the sentence is opinionated, then, the aim is to mark the opinion expression ... identifying the in uence of the modifier on the opinion For instance, the marked span in (15) is labeled as modifier=increase as it gives the impression that the author is really offended by the negative...
- 10
- 432
- 0
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx
Ngày tải lên :
17/03/2014, 03:20
... poly(A) of GT- cDNA1 and another is located 11 bp upstream from the poly(A) of GT- cDNA2 (data not shown) Of particular interest is the presence of eight AUUUA motifs in the 3¢-UTR of GT- cDNA2 ... genomic DNA and contains 12 exons and 11 introns The 5¢-UTR (203 bp) is contained in exons and 2; the coding region (1599 bp) is distributed across exons 2–12 and the 3¢-UTR is located within a 1238-bp ... encoding these domains and that there is a high selective pressure to maintain the arrangement of these exons In mammals, hypoxic stress is known to increase GLUT1 and GLUT3 expression in specific...
- 8
- 465
- 0
Báo cáo Y học: Cloning and expression of two novel aldo-keto reductases from Digitalis purpurea leaves potx
Ngày tải lên :
18/03/2014, 01:20
... elucidate the physiological role of these proteins in D purpurea Work is underway to determine the precise role of DpARs in plant steroid metabolism in general and in cardenolide biosynthesis in particular ... Y52, K81 and H114 In relation to the cosubstrate binding site, the amino acids K256, S257, R262 and N266 of DpARs would be involved in NAD(P)H binding The residues K256 and S257 are part of a typical ... function of the ARs is the catalysis of the first reaction in the polyol pathway, the reduction of glucose to sorbitol In mammals they play a role in cellular osmotic regulation [26] and are associated...
- 9
- 570
- 0