gray iron a unique engineering material
Báo cáo khoa học: Thermosynechoccus elongatus DpsA binds Zn(II) at a unique three histidine-containing ferroxidase center and utilizes O2 as iron oxidant with very high efficiency, unlike the typical Dps proteins ppt
... withprotparam (http://www.expasy.org).Removal of the His-tag A factor Xa cleavage site was created between the lastamino acid (valine) and the His-tag. Cleavage by factor Xaoccurs after an arginine, ... Listeria innocua. Biochem J 338,71–75.32 Havukainen H, Haataja S, Kauko A, Pulliainen AT,Salminen A, Haikarainen T, Finne J & PapageorgiouAC (2008) Structural basis of the zinc- and terbium-mediated ... withferroxidase activity; the two iron atoms are at a dis-tance of about 3 A ˚, and are connected by an oxo-bridge. The so-called A- site typically uses a histidineand carboxylates as iron- coordinating...
- 15
- 293
- 0
Tài liệu Báo cáo khoa học: Molecular and biochemical characterization ofD-phosphoglycerate dehydrogenase fromEntamoeba histolytica A unique enteric protozoan parasite that possesses both phosphorylated and nonphosphorylated serine metabolic pathways docx
... fragment corresponding toan open reading frame (ORF) of EhPGDH was amplifiedby PCR using a cDNA library [26] as a template, andoligonucleotide primers (5Â-caGGATCCaagatagttgtgataaccga-3Â and ... protozoan parasite Entamoeba histolytica. Mol. Biochem.Parasitol. 97, 33–44.27. Nozaki, T., Asai, T., Sanchez, L.B., Kobayashi, S., Nakazawa, M.& Takeuchi, T. (1999) Characterization of ... methionine c-lyase from Entamoeba histolytica: a key enzyme ofsulfur-amino acid degradation in an anaerobic parasitic protistthat lacks forward and reverse transsulfuration pathways. J. Biol.Chem....
- 12
- 464
- 0
Tài liệu Báo cáo khoa học: A unique variant of streptococcal group O-antigen (C-polysaccharide) that lacks phosphocholine ppt
... clearly showed thatthe majority of the material constituted of a tetrasaccha-ride and a smaller amount of a tetrasaccharide-ribitol.The data shows that the AAT residue is indeed anacetamido-amino ... 4.98) was assigned to a 3-substituted 2-acetamido-4-amino-2,4,6-trideoxy-galacto-pyranose (AAT) residue also with the a configuration, as indicated from its J1,2-value. The C-2 andC-4 in AAT were ... lipidsand nucleic acids, gave two partially overlapping peaks thatappeared at 1.3 (PSI) and 1.7 (PSII) void volumes in theeluate from a Sephacryl S-300 column. The unseparated material showed...
- 6
- 545
- 0
Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc
... CAGGCTCGTGGTGCTAAATGCCCGAACTGCCTGTGCTGTG3f GTAAGTACGGCTTCTGCGGTTCTGGTGACGCTTACTGTGG4f CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAGGGAT1r TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC2r CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG3r ... CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG3r GACTGGCAAGAACCAGCGCCACAGTAAGCGTCACCAReverse GCTAGGATCCCTAGCAACCACGGCACTable 2. Antifungal activity of WAMP- 1a. IC50is the concentrationnecessary for 50% growth inhibition.Fungi ... kiharae seeds with a unique 10-cysteine motifTatyana I. Odintsova1, Alexander A. Vassilevski2, Anna A. Slavokhotova1,Alexander K. Musolyamov2, Ekaterina I. Finkina2, Natalia V. Khadeeva1,...
- 10
- 505
- 0
Báo cáo khoa học: Exo-mode of action of cellobiohydrolase Cel48C from Paenibacillus sp. BP-23 A unique type of cellulase among Bacillales ppt
... molecular mass of118 kDa and a pI of 4.85, displayed a multidomain organ-ization bearing a canonical family 48 catalytic domain, a bacterial type 3a cellulose-binding module, and a putativefibronectin-III ... cellulase among BacillalesMarta M. Sa´nchez, F. I. Javier Pastor and Pilar DiazDepartment of Microbiology, Faculty of Biology, University of Barcelona, SpainSequence analysis of a Paenibacillus ... domain. The cloned cellulase, unique amongBacillales and designated Cel48C, was purified through a nity chromatography using its ability to bind Avicel.Maximum activity was achieved at 45 °C and...
- 7
- 404
- 0
Báo cáo khoa học: A unique vertebrate histone H1-related protamine-like protein results in an unusual sperm chromatin organization pot
... Cerebratulus californiensis and Cerebratuluslacteus. J Exp Zool 290, 431–436.16 Munoz-Guerra S, Azorin F, Casas MT, Marcet X,Maristany MA, Roca J & Subirana JA (1982) Structuralorganization ... Universitat Polite`cnica de Catalunya, Barcelona, Spain2 Departament de Cie`ncies Fisiolo`giques II, Facultat de Medicina, Universitat de Barcelona, L’Hospitalet de Llobregat, Spain3 Departamento ... source are also indicated.This material is available as part of the online articlefrom http://www.blackwell-synergy.comN. Saperas et al. Protamine-like proteins and chromatinFEBS Journal 273...
- 14
- 484
- 0
Mechanical behaviour of engineering materials
... a material is loaded with a force, the atoms within the material are dis-placed – the material responds with a deformation. This deformation deter-mines the mechanical behaviour of the material. ... fellowship at the University of California, Santa Barbara,usa, he worked at Asea Brown Boveri ag, Switzerland, from 1991 to 1996,being finally responsible for the material laboratory of abb Power ... His main research interest lies in high-temperaturematerials, the mechanical behaviour of materials, and in m aterials develop-ment.Dr Ing. Harald Harders, born in 1972, studied mechanical engineering, with...
- 540
- 397
- 0
Engineering Materials 2An Introduction to Microstructures, Processing and Design ppt
... Because aluminium is* One thinks of aluminium as a cheap material – aluminium spoons are so cheap that they are thrown away.It was not always so. Napoleon had a set of cutlery specially made ... make from copper and zinc. A binaryalloy has two components; a ternary alloy has three. A phase is a region of material that has uniform physical and chemical properties.Phases are often given ... but we can’t of course say from the phase diagram what the relativeweights of the three phases are.Other phase diagramsPhase diagrams have been measured for almost any alloy system you are likely...
- 392
- 1,415
- 0
Báo cáo khoa học: GRAIL: a unique mediator of CD4 T-lymphocyte unresponsiveness ppt
... inositolphosphate, calcium, and tyrosine kinase signalingpathways. Proc Natl Acad Sci USA 91, 38–42.44 Hundt M, Tabata H, Jeon MS, Hayashi K, Tanaka Y,Krishna R, De Giorgio L, Liu YC, Fukata M &Altman ... signaling, andultimately, mammalian target of rapamycin (mTOR)-dependent translation of select mRNA ([24] andunpublished data) (Fig. 3). In particular, IL-2R signal-ing leads to Akt and mTOR activation, ... indysregulated differentiation. Acta Haematol 122 , 230–237.64 Nakamichi S, Senga Y, Inoue H, Emi A, Matsuki Y,Watanabe E, Hiramatsu R, Ogawa W & Kasuga M(2009) Role of the E3 ubiquitin ligase...
- 12
- 337
- 0
Báo cáo khoa học: "A KNOWLEDGE ENGINEERING APPROACH TO NATURAL LANGUAGE UNDERSTANDING" pot
... NOUN. ** 'BAR IS A NOUN. *~ 'FLUID IS A MASS-NOUN. ** &apos ;MATERIAL IS A MASS-NOUN. ** 'MILK IS A MASS-NOUN. ** 'WATER IS A MASS-NOUN. ** 'GLASS IS A MASS-NOUN. ... be available to the theorist as domain knowledge. As a result of our preliminary study of a KE approach to Natural Language Understanding, we have gained valuable experience with the basic ... ** 'Y IS A VARIABLE. ** 'ON IS A RELATION. ** &apos ;A IS A G-DETERMINER. ** 'BOTTLE IS A NOUN. ** 'CONTAINER IS A NOUN. ** 'TABLE IS A NOUN. ** 'DESK IS A NOUN....
- 9
- 426
- 0
engineering materials 2e volume1 potx
... of about 104GPa. Practical engineering materials lie in the range lo” to 10+3GPa - a 22 Engineering Materials 1 Tabla 2.4 Approximate energy content of materials GJ tonne-' ... total available material. Resources are almost always much larger than reserves, but because the geophysical data and economic projections are poor, their evaluation is subject to vast uncertainty. ... solid materials available to us are silicates and alumino-silicates. A few metals appear on the list, among them iron and aluminium both of which feature also in the list of widely-used materials....
- 322
- 376
- 1
Engineering Materials 2An pptx
... aluminium as a cheap material – aluminium spoons are so cheap that they are thrown away.It was not always so. Napoleon had a set of cutlery specially made from the then-new material. It cost ... 8 Engineering Materials 2Fig. 1.4. Miniature boiler fittings made from brass: a water-level gauge, a steam valve, a pressure gauge,and a feed-water injector. Brass is so easy to machine that ... also a change in chemical composition (Fig. 2.5d). Such a phase boundary has a high energy – comparable with that of a grain boundary – and around 0.5 J m−2.Shapes of grains and phasesGrains...
- 392
- 1,117
- 0
Báo cáo khoa học: Crystal structure of the halotolerant c-glutamyltranspeptidase from Bacillus subtilis in complex with glutamate reveals a unique architecture of the solvent-exposed catalytic pocket docx
... was amplified by PCR from theplasmid pCY167 (Suzuki H & Yamada C, Unpublished),using forward primer 5Â-CATATGGATGAGTACAAACAAGTAGATG-3Â and reverse primer 5Â-GGATCCTCGAGCTCATTTACGTTTTAAATTAATGCCGAT-3Â ... 2433–2439.11 Wada K, Hiratake J, Irie M, Okada T, Yamada C,Kumagai H, Suzuki H & Fukuyama K (2008) Crystalstructures of Escherichia coli c-glutamyltranspeptidasein complex with azaserine and acivicin: ... metabolism, and its reaction intermediate.Proc Natl Acad Sci USA 103, 6471–6476.9 Boanca G, Sand A, Okada T, Suzuki H, Kumagai H,Fukuyama K & Barycki JJ (2007) Autoprocessing ofHelicobacter...
- 10
- 375
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25