gouwse boschi pinto c bryce j dye c 2002 estimates of world wide distribution of child deaths from acute respiratory infections lancet 2 1 25 32

decusatis, c. (2002). handbook of fiber optic data communication (2nd ed.)

Ngày tải lên : 18/04/2014, 10:57

... 10 .17 35 13 . 323 7 Lp 31 Lp 32 LP33 LP34 2. 4048 5. 520 1 8.6537 11 .7 915 J2 Wd = Oi; Vc # 5 .13 56 8. 41 72 11 . 619 8 14 .7960 Reprinted f o Ref [5], p 380, courtesy of CambridgeUniversity Press rm I I Fig 1. 5 The ... Optic Transceivers 14 3 14 4 14 5 14 6 15 0 1 52 15 4 15 6 15 8 15 9 Michael Langenwalter and Richard Johnson 6 .1 6 .2 6.3 6.4 6.5 6.6 6.7 6.8 Introduction Technical Description of Fiber Optic Transceivers ... 95 98 10 6 11 9 12 4 12 5 viii Contents Chapter Logic and Drive Circuitry 12 7 Ray D Sundstrom and Eric Maass 4 .1 System Overview 4 .2 Electrical Interface 4.3 Optical Interface Chapter Optical Subassemblies...

854
376
0

[H C Tan, C J Anumba] Capture And Reuse of Project Knowledge in Construction

Ngày tải lên : 06/04/2017, 02:58

... remarks 14 9 14 9 15 3 15 4 15 5 15 7 Appendix A Table Comparing the Various Knowledge Management Process Models Appendix B Appendix C Appendix D 10 6 11 9 12 0 12 0 12 1 12 1 12 4 12 5 12 9 13 1 1 32 13 4 13 6 13 9 14 0 ... knowledge 3 .2 Learning situations 3 .2. 1 Formal learning situations 3 .2. 2 Ad hoc learning situations vii ix xi 1 7 8 10 10 11 13 14 15 16 17 17 17 18 20 23 29 29 31 32 35 35 35 iii iv Contents 3.3 Current ... applying 2. 4.4 Knowledge maintenance – archiving and retirement 2. 5 KM in construction 2. 5 .1 Shortcomings of current practice 2. 5 .2 KM research projects in construction 2. 6 The importance of ‘live’ capture...

210
730
0

Văn đại hõc khối C 2002

Ngày tải lên : 01/09/2013, 17:10

1
175
0

Tài liệu Báo cáo khoa học: C-Terminal extension of a plant cysteine protease modulates proteolytic activity through a partial inhibitory mechanism doc

Ngày tải lên : 14/02/2014, 14:20

... kDa 29 kDa rmErv -C+ CT 20 kDa M 45 30 25 20 15 10 C rproErv -C CT 29 kDa 24 kDa rmErv -C CT 20 kDa M 45 30 25 20 15 10 C C B rproErv -C+ CT rproErv -C CT rmErv -C+ CT rmErv -C CT 2 Fig (A) Time course of ... 45, 13 07 13 12 30 Chen CY, Luo SC, Kuo CF, Lin YS, Wu JJ, Lin MT, Liu CC, Jeng WY & Chuang WJ (20 03) Maturarion processing and characterization of streptopain J Biol Chem 27 8, 17 336 17 343 31 King ... Bank ID 2PRE) and the modeled structure of Erv -C with CT-extension (rmErv -C+ CT) reveals that the Leu of FEBS Journal 27 8 (20 11 ) 30 12 3 024 ª 20 11 The Authors Journal compilation ª 20 11 FEBS 3 017 Role...

13
759
0

Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

Ngày tải lên : 16/02/2014, 09:20

... A (20 02) tBID Homooligomerizes in the mitochondrial FEBS Journal 27 7 (20 10 ) 13 19 13 30 ª 20 10 The Authors Journal compilation ª 20 10 FEBS 1 329 Itch promotes tBid degradation 24 25 26 27 28 29 ... extract, both in control conditions and in the presence of FLAG–Itch, was observed (Fig 1D, lanes 3, FEBS Journal 27 7 (20 10 ) 13 19 13 30 ª 20 10 The Authors Journal compilation ª 20 10 FEBS 1 3 21 Itch ... using spss 16 .0 .1 (SPSS, Chicago, IL, USA) The statistical signiﬁcance of the differ- FEBS Journal 27 7 (20 10 ) 13 19 13 30 ª 20 10 The Authors Journal compilation ª 20 10 FEBS B A Azakir et al ences was...

12
718
0

Tài liệu Báo cáo khoa học: DNA modiﬁcation with cisplatin affects sequence-speciﬁc DNA binding of p53 and p73 proteins in a target site-dependent manner pptx

Ngày tải lên : 19/02/2014, 05:20

... DNA comprises about 50% of 1 ,2- GG IACs, 25 % of 1 ,2- AG IACs, 10 % of 1, 3-GNG IACs and interstrand crosslinks, and another 2 3% of monofunctional adducts It has been found that cisplatin cytotoxicity ... Biol 81, 14 1 15 0 12 Palecek E, Brazda V, Jagelska E, Pecinka P, Karlovska L & Brazdova M (20 04) Enhancement of p53 sequencespeci c binding by DNA supercoiling Oncogene 23 , 21 19 21 27 13 Dornan D, ... protein p53 and character of DNA adducts of this cytotoxic complex FEBS J 27 3, 3 01 314 Vojtesek B, Bartek J, Midgley CA & Lane DP (19 92) An immunochemical analysis of the human nuclear phosphoprotein...

14
597
0

Tài liệu Báo cáo khoa học: Speciﬁc membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

Ngày tải lên : 19/02/2014, 05:20

... PtdIns(3,4)P2 ⁄ PC PtdIns(3,4,5)P3 ⁄ PC ND ND 16 ± 10 ± 5.9 ± ND 15 ± 16 ± ND ND 24 ± 17 ± 18 ± 46 ± 49 ± 25 ± d1 18 IC M )1 Æs )1) 3.7 1. 6 0.44 9 .1 0. 71 1 .1 5.3 3.3 4.4 24 1. 7 the positively charged ... phospholipases A2 Biochemistry 40, 46 72 4678 Cho W (20 01) Membrane targeting by C1 and C2 domains J Biol Chem 27 6, 324 07– 324 10 FEBS Journal 27 3 (20 06) 5374–5383 ª 20 06 The Authors Journal compilation ª 20 06 ... Hayashi R (20 02) Overexpression and functional characterization of a serine carboxypeptidase inhibitor (IC) from Saccharomyces cerevisiae J Biochem 1 32, 967–973 Mima J, Kondo T & Hayashi R (20 02) N-terminal...

10
645
1

Tài liệu Báo cáo khoa học: Multiple promoters regulate tissue-speciﬁc alternative splicing of the human kallikrein gene, KLK11⁄hippostasin ppt

Ngày tải lên : 19/02/2014, 06:20

... GCCTTGCTCCACACCTG-3¢; F 1c, 5¢-CTGCCGTCTCC GCCGCCACT-3¢; FU, 5¢-TCAAGCCCCGCTACATAG TT-3¢; and R3, 5¢-AGGAACCAAACACCAAGTGG-3¢ (Fig 2A) Luciferase promoter assay Human genomic DNA was isolated from two volunteers ... The PCR primers were: FEBS Journal 27 3 (20 06) 3678–3686 ª 20 06 The Authors Journal compilation ª 20 06 FEBS S Mitsui et al F1a, 5¢-GGACTCAAGAGAGGAACCTG-3¢; F1b, 5¢-CT GCCTTGCTCCACACCTG-3¢; F 1c, ... disease Psychiatry Clin Neurosci 54, 419 – 426 13 Diamandis EP, Okui A, Mitsui S, Luo LY, Soosaipillai A, Grass L, Nakamura T, Howarth DJ & Yamaguchi 3686 14 15 16 17 18 19 20 21 22 23 24 N (20 02) Human...

9
544
0

Tài liệu Báo cáo khóa học: The C-terminal domain of Escherichia coli Hfq increases the stability of the hexamer ppt

Ngày tải lên : 19/02/2014, 12:20

... processing package for electron microscopy J Struct Biol 11 6, 23 7 24 0 Marabini, R & Carazo, J. M (19 94) Pattern recognition and classification of images of biological macromolecules using artificial neural ... Pearson, R.F., Moller, T., Valentin-Hansen, P & Brennan, R.G (20 02) Structures of the pleiotropic transla- 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 ... FEBS 20 04 The role of the C- terminal domain on Hfq (Eur J Biochem 27 1) 12 5 9 the model further confirmed by determination of the X-ray structure of Staphylococcus aureus and E coli Hfq proteins [19 ,20 ]...

8
427
0

Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf

Ngày tải lên : 20/02/2014, 01:20

... 1 29 2), ATnI1) 12 8 (recombinant fragment consisting of residues 1 12 8 of 52K-TnI), ATnI -19 K (recombinant 19 K-TnI; residues 13 0 29 2), ATnI130 )25 2 (fragment; residues 13 0 25 2), and ATnI2 32) 2 92 (fragment; ... CTATCTTCTGGCTTCC-3¢), ATnI130F (5¢-GCCAGAA CCATGGCGGAGGAAC-3¢) and ATnI292R, ATnI130F and ATnI252R (5¢-CAAGTTTGGGATCCTATTTGTTAA CTTTTC-3¢), and ATnI232F (5¢-CGAGATTAATGCC ATGGCACTTAAGG-3¢) and ATnI292R, ... 23 2 29 2), combinations of the forward and reverse primers, ATnI1F (5¢-CATATCACCATGGGTTCCCTTG-3¢) and ATnI292R (5¢-CTTGATTTGGATCCTTTAAGGTA TAGC-3¢), ATnI1F and ATnI 12 8 R (5¢-GTTCCGGATC CTATCTTCTGGCTTCC-3¢),...

12
514
0

Tài liệu Báo cáo khoa học: The distinct nucleotide binding states of the transporter associated with antigen processing (TAP) are regulated by the nonhomologous C-terminal tails of TAP1 and TAP2 ppt

Ngày tải lên : 20/02/2014, 02:21

... GACGCCGAGTGCG-3¢ and 5¢-CGCACTCGGCGTC CAGGGCACTGGTGGCATCGTCC-3¢ and complementary primers 5¢-GGATGAGGCTACCAGTGCCCT GGATGCTGGCAACC-3¢ and 5¢-GGTTGCCAGCATC CAGGGCACTGGTAGCCTCATCC-3¢ for 2V1 The ... the complementary primers 5¢-GGACGATGCCACCAGTACTCTG GATGCTGGCAACC-3¢ and 5¢-GGTTGCCAGCATCC AGAGTACTGGTGGCATCGTCC-3¢ and for TAP2 the complementary primers 5¢-GGATGAGGCTACCAGTAC TCTGGACGCCGAGTGCG-3¢ ... 5¢-CGCACTCGGC GTCCAGAGTACTGGTAGCCTCATCC-3¢ All primers were purchased from ARK/Sigma The chimeric TAP construct 1V2 was created by ligation of the 1. 6 kb ScaIfragment containing the C- terminus of...

16
407
0

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Ngày tải lên : 20/02/2014, 11:20

... (m (16 H, P+–ArH and H -11 ), 7.46 (1H, s, H-6), 6.49 (1H, s, H-9), 4 .1 4 .2 (2H, m, Ar-O-CH2), 3. 71 (3H, s, O-CH3), 3.4– 4.0 (5H, m, P+–CH2, H -11 a and H-3), 1. 75 2. 4 (8H, m, O-CH2-CH2, P+–CH2-CH2, ... antibiotics Proposed structures and characteristics of the in vitro deoxyribonucleic acid adducts of anthramycin, tomaymycin, sibiromycin, neothramycins A and B Biochemistry 20 , 11 11 11 19 28 Hertzberg, ... MERRF mitochondrial DNA mutations Biochem J 318 , 4 01 407 42 Brown, G .C & Brand, M.D (19 85) Thermodynamic control of electron ﬂux through mitochondrial cytochrome bc1 complex Biochem J 22 5, 399–405...

10
638
0

Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf

Ngày tải lên : 06/03/2014, 11:20

... Dzz) )1 (ns) s2 = (Dxx + 4Dyy + Dzz) )1 (ns) s3 = (Dxx + Dyy + 4Dzz) )1 (ns) 0 .1 02 0. 12 5 0 .14 0 14 .86 13 .48 12 . 71 0 .10 1 0. 12 8 0 .13 9 14 .90 13 .30 12 . 74 26 24 ± ± ± ± ± ± 0.0 02 0.003 0.003 0 .18 0 .22 0 .19 ... FEBS Journal 27 7 (20 10 ) 26 11 26 27 ª 20 10 The Authors Journal compilation ª 20 10 FEBS A B Mantsyzov et al 10 11 12 13 14 15 16 17 domain of release factor eRF1 functions in stop codon recognition ... degradation RNA 1, 610 – 623 FEBS Journal 27 7 (20 10 ) 26 11 26 27 ª 20 10 The Authors Journal compilation ª 20 10 FEBS 26 25 NMR structure and function of the eRF1 C- domain A B Mantsyzov et al 30 Czaplinski...

17
490
0

Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

Ngày tải lên : 07/03/2014, 04:20

... site-directed mutagenesis were as follows: 5¢-TTCGA GGCCCGCGCCGCAATTGGGGGCCCAGAA-3¢ and 5¢TTCTGGGCCCCCAATTGCGGCGCGGGCCTCGAA-3¢ for E190A, 5¢-ATTCCGGTTACTTTCGCGGCCCGCGC CCAAATT-3¢ and 5¢-AATTTGGGCGCGGGCCGCGA ... 5¢-AATTTGGGCGCGGGCCGCGA AAGTAACCGGAAT-3¢ for E190A, 5¢-CAAATTGGGGG CCCAGCAGCTGGGAAGTCTGAA-3¢ and 5¢-TTCAGA CTTCCCAGCTGCTGGGCCCCCAATTTG-3¢ for E199A, and 5¢-GAAGCTGGGAAGTCTGCACAGTCTGGAGCC AAG-3¢ and 5¢-CTTGGCTCCAGACTGTGCAGACTTCC ... n 2 n 3 ) 2 + p p p + n 1 ) 1 p n n p n n n n n + 3 1 1 1 1 0 0 17 18 16 13 14 14 1 10 1 1 1 4 1 3 FEBS Journal 27 5 (20 08) 5885–5898 ª 20 08 The Authors Journal compilation ª 20 08 FEBS 1 1 2 1...

14
417
0

Báo cáo khoa học: C Isotopologue editing of FMN bound to phototropin domains potx

Ngày tải lên : 07/03/2014, 05:20

... CCAGGTCACCCAATCATGTACGCAAGCGCTGGTTTCTTCAACATGACCGGTTACACATCCAAG ACTTACTTCCACTTGCATGCCGATGAACTTGAGGACACGACCTTCTTCATCCTTGATTGGTGCAATGG GCACTGTCCGCATTCCAACAGACCTTCGTAGTTTCGGACGCCAGCCGTCCAGGTCACCCAATCATGTACGCAAG ... GACATCGCGCTGCTCCTTGACTGCATCACGGATCAGCTGCACTGCTTTACGATCAGTACCGCGGCC CATCTTCGCGAGTGACCGGTTTCTGGAGCTCACGGAGTATACACGTGAGGAAGTCCTAGGTAACAACTGC CCAAAAGGCGCGCCCACCTTTTGTATAGTTTAAAACCTGTACAGTGACATCGCGCTGCTCCTTGACTGC AAGTCTTTCGTGATCACAGATCCTCGTTTACCAGACAACCCTATCATCTTCGCGAGTGACCGGTTTCTG ... AGTTTCTTGCAGTTGACAGAATATTCGCGAGAAGAAATTCTGGGTCGTAACTGCCGTTTTCTTCAAGGTCC CACGCTCGGCCGCATCACGGACATGTTCGGTACCATCCAACTGGACACCAATAAAGTACTGGACATC GTCATTACTGACCCACGTTTGCCAGATAATCCCATTATCTTCGCGTCCGATAGTTTCTTGCAGTTGACAGAATATTC...

15
262
0

Báo cáo khoa học: Structural mobility of the monomeric C-terminal domain of the HIV-1 capsid protein pptx

Ngày tải lên : 07/03/2014, 06:20

... Spectrosc 33, 20 7 27 2 Palmer AG, Willimas J & McDermott A (19 96) Nuclear magnetic resonance of biopolymer dynamics J Phys Chem 10 0, 1 329 3 13 310 Freed EO (19 98) HIV -1 gag proteins: diverse functions ... HIV -1 particle Curr Biol 7, 729 –738 FEBS Journal 27 5 (20 08) 329 9–3 311 ª 20 08 The Authors Journal compilation ª 20 08 FEBS L A Alcaraz et al 11 Ehrlich LS, Agresta BE & Carter CA (19 92) Assembly of ... K (20 07) Critical role of helix of HIV -1 capsid C- terminal domain in interactions with human lysyl-tRNA synthetase J Biol Chem 28 2, 322 74– 322 79 Peng JW & Wagner G (19 92) Mapping of the spectral...

13
421
0

Báo cáo khoa học: Molecular imprinting of cyclodextrin glycosyltransferases from Paenibacillus sp. A11 and Bacillus macerans with c-cyclodextrin pptx

Ngày tải lên : 07/03/2014, 10:20

... 2. 1 · 1 02 1 .2 · 1 02 1. 8 · 1 02 1. 1 · 10 3 1. 60 ± 0 .20 0.63 ± 0.04 0 .25 ± 0.04 4 .2 · 1 02 2 .1 · 1 02 9.4 · 10 1 2. 6 · 10 5 3.3 · 10 5 3.8 · 10 5 1. 30 ± 0. 02 1. 11 ± 0.05 0.59 ± 0. 02 1. 6 · 10 1 6.3 · 10 0 5.3 ... (mgÆmL )1) kcat (s )1) kcat ⁄ Km (mgÆmL )1 s )1) 0.83 ± 0.03 0.50 ± 0. 02 0 . 21 ± 0. 01 1.6 · 1 02 2.5 · 1 02 4.9 · 1 02 1. 9 · 1 02 5.0 · 1 02 2.3 · 10 3 0.90 ± 0 .20 0.55 ± 0. 02 0 .26 ± 0. 01 1 .2 · 1 02 1. 1 · 1 02 1. 0 ... · 1 02 1. 3 · 10 5 2. 0 · 10 5 3.8 · 10 5 1 .25 ± 0.03 1. 08 ± 0. 01 0.48 ± 0.04 3 .2 · 10 1 8.0 · 10 0 5.5 · 10 0 2. 9 · 10 1 6.4 · 10 0 1. 1 · 10 1 0.55 ± 0. 02 0.50 ± 0. 01 0 .20 ± 0. 01 6.7 · 10 1 9.0 · 10 1 2. 1...

10
562
0

Báo cáo khoa học: The variable C-terminal extension of G-protein-coupled receptor kinase 6 constitutes an accessorial autoregulatory domain ppt

Ngày tải lên : 07/03/2014, 12:20

... (Stratagene, La Jolla, CA) (18 cycles: 94 C for min, 55 C for min, 72 C for min, followed by a single incubation at 72 C for 10 min) using primer P1, 5¢-CGCCA AGATTCCTCTGGGAACTCCAGCGACAGT-3¢ (nucleotides ... 26 9, 27 7 91 27 794 20 Loudon RP & Benovic JL (19 97) Altered activity of palmitoylation-deﬁcient and isoprenylated forms of the G protein-coupled receptor kinase GRK6 J Biol Chem 27 2, 27 422 27 427 21 ... Nature 3 71, 16 8 17 0 31 Onorato JJ, Gillis ME, Liu Y, Benovic JL & Ruoho AE (19 95) The b-adrenergic receptor kinase (GRK2) is regulated by phospholipids J Biol Chem 27 0, 21 346 21 353 32 Pitcher JA,...

13
424
0

Báo cáo khoa học: Ligand-speciﬁc dose–response of heterologously expressed olfactory receptors potx

Ngày tải lên : 08/03/2014, 02:21

... specifically amplify the target cDNA by PCR on the first strand: 5-ATggAgCAgAAACTC ATCTCTgAA-3¢ and 5¢-TTCTgCAgCTAACCAATTTTg CTgCCTTTgTT-3¢ for I7, 5-CgggATCCATgCAgCCA gAATCTggggCC-3¢ and 5¢-CCgCTCgAgTCAAgCCAg ... and 5¢-CCgCTCgAgTCAAgCCAg TgACCgCCTCCC-3¢ for OR17-40 Each PCR consisted of 40 cycles: 94 C/ 60 C/ 72 C with steps, with a final elongation of 10 at 72 C PCR products were sequenced (Genome Express) ... Biochem 27 0) 10 11 12 13 14 15 16 17 18 19 20 semiliki forest virus vectors J Receptor Signal Transd Res 19 , 687–7 01 Gimelbrant, A.A., Stoss, T.D., Landers, T.M & McClintock, T.S (19 99) Truncation...

8
313
0

C++?? A Critique of C++ and Programming and Language pot

Ngày tải lên : 08/03/2014, 23:20

... and copy of a temporary object (S 12 . 2).” Section 12 . 2 explains: “In some circumstances it may be necessary or convenient for the compiler to generate a temporary object Such introduction of temporaries ... static type checks can reject a class of programs that are otherwise type valid List classes are an example of where static type checking can reject a valid program A list class can contain objects ... functions on a class: i: INTEGER ch: CHARACTER © Ian Joyner 19 96 C+ +?? 24 i := ch.ord // i becomes the integer value of the character ch := i.char // ch becomes the character corresponding to...

63
511
0