glycolysis overall energy metabolism and drug metabolism under a systems biology approach
Báo cáo hóa học: " A systems biology approach to analyse leaf carbohydrate metabolism in Arabidopsis thaliana" pdf
... this article as: Henkel et al.: A systems biology approach to analyse leaf carbohydrate metabolism in Arabidopsis thaliana EURASIP Journal on Bioinformatics and Systems Biology 2011 2011:2 Abbreviations ... and measured minimal and maximal total concentration changes of soluble carbohydrates vC, and vC, max, respectively vC, and vC, max were calculated as already described for vSt, and vSt, max by ... presented a kinetic modelling approach to simulate and analyse diurnal dynamics of carbohydrate metabolism in A thaliana Based on simulated fluxes in leaf cells, we could assign possible physiological...
- 10
- 356
- 0
Báo cáo khoa học: Pyruvate:ferredoxin oxidoreductase and bifunctional aldehyde–alcohol dehydrogenase are essential for energy metabolism under oxidative stress in Entamoeba histolytica pdf
... PFOR has been described for anaerobic bacteria such as Bacteroides [26], D africanus [25,27] and several anaerobic human parasites from the genera Entamoeba [11], Trichomonas [20] and Giardia [21] ... mm acetyl-CoA Basal activity with NADH and the extract was always subtracted Complete inhibition of the ADH activity with pyrazole was determined separately in the ADH assay Acetyl-CoA synthetase ... Biomedicals (Aurora, OH, USA); Nitro Blue tetrazolium was from Amersham (Parklands, Rydelmare, Australia); Triton X-100 was from Bio-Rad (Hercules, CA, USA); sodium dithionite, acetic acid and n-butanol...
- 14
- 420
- 0
Báo cáo khoa học: Transmembrane helix 12 plays a pivotal role in coupling energy provision and drug binding in ABCB1 pot
... labelling according to the following relationship: t1=2 ¼ Ln2=k Statistical analysis All data manipulations and statistical analyses were performed using graphpad prism 4.0 Comparison of datasets ... AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped ++ +++ +++ ++ +++ +++ +++ +++ ... to undergo topographical alterations during conformational changes of ABCB1 In a recent study, we demonstrated, using a similar approach, that the mutation of several residues within TM12 also...
- 12
- 380
- 0
Financing energy efficiency and climate change migration a guide for investors in belarus, bulgaria, kazakhstan, the russian federation, and ukraine new york geneva, 2005
... TOTAL I 1665.7 I 100 I 9600.6 100 I 11266.3 I 100 I 'Indudes Australia, Canada, New Zealand, USA, Turkey, and Japan "Indudes Albania, Bosnia and Herzegovina, Macedonia, Croatia, and Serbia and ... its capital since 1998 Astana, as well as Almaty, Karaganda, and Shymkent Kazakh is the state language, but Russian is widely used Kazakhs amount to approximately 53 percent of the total population, ... population was estimated at 7.5 million Reasons for this decrease are a low biah rate, aging, and emigration? Before 1990 Bulgaria was under strong Soviet political and economic influence and was an active...
- 253
- 603
- 0
Báo cáo y học: " Dideoxynucleoside HIV reverse transcriptase inhibitors and drug-related hepatotoxicity: a case report" pot
... Liver transaminase and therapeutic evolution in the study patient Liver transaminase and therapeutic evolution in the study patient ALT: alanine-amino transferase; AST: aspartateamino transferase; ... IU/L and AST 373 IU/L HCV-RNA, HBV-DNA, HAV-IgM resulted negative again, as well as CMV DNA, CMV early-antigen, Epstein-Barr virus sierology and markers indicating autoimmune hepatitis A venous ... ritonavir could not be excluded as causative agent of the first episode of transaminase elevation Although transaminase levels appeared to partially ameliorate after boosted-PI discontinuation, ALT...
- 5
- 443
- 0
Energy, exergy and environmental analysis of a hybrid combined cooling heating and power system utilizing biomass and solar energy
... there are continuous energy and matter enter and leave in each components The energy balance, mass balance and solute equilibrium can be summarized as [29]: Table Design parameters of solar evacuated ... the vapor, respectively hlv (kJ/kg) is the latent heat of vaporization, and Psat and Pa (kPa) are the pressures of the saturated vapor and ambient, respectively Tc and Lc are the temperature and ... contains pyrolysis and gasification modules and considers the residual tar and char, which were simulated and validated for biomass air gasification preferably Using that biomass gasification model,...
- 12
- 428
- 0
Stocks, Bonds and the Investment Horizon: A Spatial Dominance Approach docx
... literatura acad´mica est´ en desacuerdo e a esta recomendaci´n En este trabajo se utiliza una prueba de dominancia espacial que es o apropiada para comparar inversiones alternativas cuando sus ... distribuciones var´ a trav´s ıan e del tiempo Utilizando datos diarios para los Estados Unidos de 1965 a 2008, se realiza una prueba de dominancia para las series de retornos acumulados de acciones contra ... Spatial Analysis prices are nonstationary For this case, it is useful to read the data along the spatial axis This is in particular useful for series that take repeated values over a certain range...
- 32
- 373
- 0
Báo cáo khoa học: "Automatic Grammar Induction and Parsing Free Text: A Transformation-Based Approach" pptx
... a new approach for learning a g r a m m a r to a u t o m a t i c a l l y parse text The method can be used to obtain high parsing accuracy with a very small training set Instead of learning a ... to Natural Language - AAAI Technical -Report American Association for Artificial Intelligence, 1992 [BR93] [Bri92] [Bri93] [BW92] [PS92] E Brill and P Resnik A transformation based approach to ... Carroll and E Charniak Learning probabilistic dependency grammars from labelled text - aaai technical report In Proceedings of the Fall Symposium on Probabilisiic Approaches to Natural Language...
- 7
- 254
- 0
báo cáo khoa học: " A systems biology model of the regulatory network in Populus leaves reveals interacting regulators and conserved regulation" potx
... not trained on drought stress data Another module (characterized by motifs AS~TATAbox, AT~TATA-box, BN~TATA-box, PC~Box_4 and ZM~TATA-box) was affected by the removal of the budset data and is ... programs have generated adequate quantities of high-quality data to enable systems analysis [6] For example, Carerra et al [4] modeled the transcriptional network of Arabidopsis and identified plantspecific ... carried out module discovery and network inference, and drafted the manuscript All authors participated in discussions, analysis and interpretation, and wrote the manuscript All authors read and...
- 15
- 386
- 0
Báo cáo khoa học: Galanin-like peptide and the regulation of feeding behavior and energy metabolism pptx
... indicate the amino acid sequences that are common to galanin and GALP Galanin and GALP are encoded by separate genes that are typically located on separate chromosomes: the GALP gene is located ... homeostatic regulation of energy balance? Neuropharmacology 55, 1–7 34 Takenoya F, Aihara K, Funahashi H, Matsumoto H, Ohtaki T, Tsurugano S, Yamada S, Katoh S, Kageyama H, Takeuchi M et al (2003) ... The Authors Journal compilation ª 2010 FEBS 5009 GALP in feeding and energy metabolism K Shiba et al Effect of GALP on feeding behavior and energy metabolism Galanin and biologically active fragments...
- 8
- 503
- 0
Báo cáo y học: "Regional characterization of energy metabolism in the brain of normal and MPTP-intoxicated mice using new markers of glucose and phosphate transport" doc
... mice and rats J Cereb Blood Flow Metab 2009, 29:1579-1588 40 Suh SW, Aoyama K, Alano CCanderson CM, Hamby AM, Swanson RA: Zinc inhibits astrocyte glutamate uptake by activation of poly(ADP-ribose) ... white-matter tracts are not labeled for GLUT1 (Alexa 488 signal and Hoechst signals merged); F: Cerebellum staining: The granular layer (GL) and the molecular layer (ML) are irregularly labelled ... whereas the molecular layer is homogeneously labelled for PiT1 and PiT2 (Alexa 488 signal and Hoechst signals merged) Scale bar: 100 μm Cerebellum staining: the granular layer was irregularly labelled...
- 9
- 776
- 1
Báo cáo khoa học: Isocitrate dehydrogenase of Plasmodium falciparum Energy metabolism or redox control? doc
... 5¢-GCGCGCGGTCTCCGCGCA TGGGAAAGCATATACGAATTTTAAAAAATCAAT ACC-3¢ and antisense 5¢-GCGCGCGGTCTCTATCA TTATGTTGAATGTTCTTGGGGAGC-3¢) containing BsaI restriction sites and Pfu polymerase (Stratgene), ICDH was amplified ... GTCTCGAATGAACATATGCGGTAAAATTAACGT AG-3¢ and antisense 5¢-GCGCGCGGTCTCAGCGCT TGTTGAATGTTCTTGGGGAGC-3¢ containing BsaI restriction sites and ICDH-1 as a template and the following PCR programme: at ... fractions that also contain enzyme activity Characteristics of P falciparum ICDH P falciparum ICDH-2 is specific for NADP+ and does not accept NAD+ at detectable rates The Kmapp for NADP+ was determined...
- 9
- 345
- 0
Báo cáo khoa học: P NMR studies of energy metabolism in xanthosine5¢-monophosphate overproducing Corynebacterium ammoniagenes pot
... concentrations in the phase I Intracellular ATP and ADP concentrations in phase I were estimated based on 31P NMR data The data shown are the mean ± SD Fig Changes in cellular ATP, ADP and ATP/ADP of the ... phase (A) Cellular ATP (s) and ADP (d) concentrations are shown (B) Cellular NADP (j) is shown To quantify the intracellular metabolites, MDP was used as a concentration standard in the NMR All ... from the accumulated XMP and inorganic phosphate added as K2HPO4 and KH2PO4 for essential substrates for XMP production During phase I, ATPb and ATPc plus ADPb signals were maintained at very...
- 5
- 304
- 0
Báo cáo khoa học: Energy metabolism in tumor cells pot
... Krebs cycle as 2-oxoglutarate); (4) acetoacetate and b-hydroxibutyrate are actively oxidized to acetyl CoA by means of an increased succinyl-CoA acetoacetyl transferase; and (5) a fraction of mitochondrial ... metastases, interleukin-6 is associated with cancer cell invasion, and haptoglobin is associated with implantation and angiogenesis [156] Aspirin, a nonsteroidal anti-inflammatory drug (NSAID) ... (breast adenocarcinoma MCF-7 and SK-BR-3 cells, synovial sarcoma SW 982 cells and chondrosarcoma SW 1353 cells) than in normal mitochondria [185]; and in prostate and hepatocellular carcinoma, the...
- 26
- 342
- 0
Báo cáo y học: "Proteome analysis of schizophrenia patients Wernicke''''s area reveals an energy metabolism dysregulation" potx
... primary auditory cortex (Brodmann's Areas (BA) 41 and 42) and the Wernicke's area (WA), also described as the posterior region of BA22 WA is an important region for speech processing and language ... differentially expressed ATP synthase subunits, ATP6V 1A (ATPase, H+ transporting, lysosomal 70 kDa, V1 subunit A) and ATP 5A1 (ATP synthase subunit alpha, mitochondrial) The above-mentioned proteins, and ... be an alternative to validate the markers and to skip possible errors As was found for other brain regions, our data suggest an overall energy metabolism dysregulation in WA of SCZ patients Beasley...
- 8
- 274
- 0
Báo cáo y học: "Prevalence of Overactive Bladder, its Under-Diagnosis, and Risk Factors in a Male Urologic Veterans Population"
... 68 years old (quartile range: 59-77) The major ethnicities were European American (44%), African American (37%) and Hispanic American (11%) Table Demographics Characteristics, n (%) Age, years ... Statistical analyses were performed using Stata 8.2 (StataCorp, College Station, TX) RESULTS Among the male patients, 1086 completed the questionnaire Table summarizes the demographic data Mean age was ... Not stated Race African American Hispanic White Asian Other Not stated Education Less than high school High school graduate Some college/college graduate Graduate school Not stated Body mass index...
- 4
- 520
- 0
Báo cáo y học: "Advances in Molecular Diagnosis of HBV Infection and Drug Resistance"
... Tables and Figures Table Advantages and disadvantages of HBV DNA testing Advantages Disadvantages Earliest indicator of infectivity Definitive role in patient management still to be clarified Can ... HBV DNA titers, it is understandable that considerable variation in results may occur when using different viral load tests This makes standardization of HBV DNA viral load assays an important ... capture approach, branched DNA) and (ii) DNA amplification tests based on the polymerase chain reaction (PCR) [for detailed reviews, see 2,5] Signal amplification assays have sensitivities approaching...
- 9
- 590
- 0
Continuous Anaerobic Digestion of Food Waste and Paper Waste under Mesophilic-Dry Condition
... Radwan A M., Sebak H A. , Mitry N R., El-Zanati E A and Hamad M A (1993) Dry anaerobic fermentation of agricultural residues, Biomass and Bioenergy, 5(6), 495499 - 175 - Saxena R C., Adhikari ... Gioannis G D., Muntoni A. , Cappai G and Milia, S (2009) Landfill gas generation after mechanical biological treatment of municipal solid wastes, Estimation of gas generation rate constants, Waste ... failure of the whole system The growth rate of the acidogenic bacteria is much higher than that of methanogenic archea, and the bacteria can be active at a weak acidic condition whereas the archea...
- 10
- 527
- 0
Changes of temperature data for energy studies over time and their impact on energy consumption and CO2 emissions. The case of Athens and Thessaloniki – Greece
... Organization for Standardization, 2008 [2] ASHRAE Handbook of Fundamentals, American Society of Heating, Refrigerating and AirConditioning Engineers, Atlanta, USA, 2009 [3] Papakostas K.T Estimation ... differences are discussed Temperature data analysis 2.1 Air temperature Average temperature is a prime climate indicator and the basis for calculations of heating and cooling energy demand [1] or ... energy demand in Switzerland Energy and Buildings 2005, 37, 1175-85 Cartalis C., Synodinou A. , Proedrou M., Tsangrassoulis A. , Santamouris M Modifications in energy demand in urban areas as a...
- 14
- 548
- 0
Energy efficiency and cost analysis of canola production in different farm sizes
... regional energy requirements and CO2 emissions in China Energy Policy 2007, 35(3), 1685-1700 [4] Mohammadi A. , Tabatabaeefar A. , Shahin S., Rafiee S., Keyhani A Energy use and economical analysis ... Ghorbani R., Mondani F., Amirmoradi S., Feizi H., Khorramdel S., Teimouri M., Sanjani S., Anvarkhah S., Aghel H A case study of energy use and economical analysis of irrigated and dryland wheat ... revealed that, total energy input in large farms was significantly higher than that of small and medium farms; also, the yield value of canola in small farms was significantly lower than that...
- 8
- 473
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25