genetics and biosynthesis of lipid a

Báo cáo khoa học: Fatty acid composition of chylomicron remnant-like particles influences their uptake and induction of lipid accumulation in macrophages pot

Báo cáo khoa học: Fatty acid composition of chylomicron remnant-like particles influences their uptake and induction of lipid accumulation in macrophages pot

Ngày tải lên : 16/03/2014, 12:20
... bands were quantified by absorbance volume analysis Cell protein content was measured by the method of Lowry et al [44] with BSA as standard Statistical analysis Data were analysed by two-way analysis ... Hepatic lipase may act as a ligand in the uptake of artificial chylomicron remnant-like particles by isolated rat hepatocytes Biochem J 299, 889–894 31 Lambert MS, Avella MA, Botham KM & Mayes PA ... accumulation in macrophages C De Pascale et al 25 Bravo E, Ortu G, Cantafora A, Lambert MS, Avella M, Mayes PA & Botham KM (1995) Comparison of the hepatic uptake and processing of cholesterol...
  • 9
  • 349
  • 0
Báo cáo khoa học: Purification, characterization and biosynthesis of parabutoxin 3, a component of Parabuthus transvaalicus venom pptx

Báo cáo khoa học: Purification, characterization and biosynthesis of parabutoxin 3, a component of Parabuthus transvaalicus venom pptx

Ngày tải lên : 31/03/2014, 09:20
... C-terminal arginine, was designed as follows (Fig 3A) Two overlapping oligonucleotide pairs 5¢-GAGGTCGACATGCGCTGCA AGTCGTCGAAGGAGTGCCTGGTCAAGTGCAAG CAG-3¢, 3¢-CTCCAGCTGTACGCGACGTTCAGCAG CTTCCTCACGGACCAGTTCACGTTCGTCCGCTG ... CTTCCTCACGGACCAGTTCACGTTCGTCCGCTG CCCGGCC-5¢, and 5¢-GCGACGGGCCGGCCGAACG GCAAGTGCATGAACCGGAAGTGCAAGTGCTAC CCGTGAG-3¢, 3¢-GGCTTGCCGTTCACGTACTTGGC CTTCACGTTCACGATGGGCACTCCTAG-5¢, respectively, ranging ... vector-related fragments In a parallel experiment with AgTx2, chromatographic profiles of rAgTx2 and commercially available rAgTx2 (Alomone Laboratories) under the same conditions were compared and were...
  • 12
  • 502
  • 0
kumar - molecular genetics and breeding of forest trees (haworth, 2004)

kumar - molecular genetics and breeding of forest trees (haworth, 2004)

Ngày tải lên : 03/04/2014, 12:10
... K Arora, and S S Prihar Bacterial Disease Resistance in Plants: Molecular Biology and Biotechnological Applications by P Vidhyasekaran Handbook of Formulas and Software for Plant Geneticists and ... expression and array hybridization data Scientists can now search and retrieve publicly available data that includes DNA and protein arrays as well as SAGE data More crucial issues facing bioinformaticians ... Tokyo, Japan Santiago Espinel, Nekazal Ikerketa eta Garapenenako Euskal Erakundea (NEIKER), Vitoria, Alava, Spain Patricia Faivre-Rampant, Joint Research Unit of Université Henri Poincaré and Institut...
  • 468
  • 405
  • 0
the genetics and biology of sex determination - novartis foundation

the genetics and biology of sex determination - novartis foundation

Ngày tải lên : 08/04/2014, 13:09
... Research Unit, Research School of Biological Sciences,The Australian National University, Canberra, ACT 2601, Australia vii viii PARTICIPANTS Andrew Green¢eld MRC Mammalian Genetics Unit, Harwell, ... function as both an architectural protein in a similar way to SRY (by virtue of its HMG box DNA binding domain; Pontiggia et al 1994), and a transcriptional activator (it has a strong activation domain ... WT1 and its various isoforms (A) Through a combination of alternative splicing (exon and exon 9) RNA editing (exon 6) and three alternative translation start sites, as many as 24 di¡erent isoforms...
  • 275
  • 419
  • 0
GENETICS AND ETIOLOGY OF DOWN SYNDROME pdf

GENETICS AND ETIOLOGY OF DOWN SYNDROME pdf

Ngày tải lên : 28/06/2014, 05:20
... 313 Radek Vodicka, Radek Vrtel, Jana Böhmova, Romana Kratochvilova, Ladislav Dusek, Ishraq Dhaifalah and Jiri Santavy Preface This book provides the recent developments and advances in research ... DSCR-1 Deters Cancer and Septic Inflammation Takashi Minami Chapter Down Syndrome and Vascular Disease: DSCR1 and NFAT Signaling 137 Monica Y Lee and Brian R Wamhoff 121 VI Contents Part Down Syndrome ... central α-satellite DNA and followed distal by Sat I DNA (Waye et al., 1989; Mitchell et al., 1992; Tagarro et al., 199 4a, 1994b) The main part of the long arm is euchromatic AT- and GC-rich bands...
  • 340
  • 228
  • 0
GENETICS AND PATHOPHYSIOLOGY OF ESSENTIAL HYPERTENSION doc

GENETICS AND PATHOPHYSIOLOGY OF ESSENTIAL HYPERTENSION doc

Ngày tải lên : 28/06/2014, 15:20
... infarction, stroke, heart failure and renal failure The cause of essential hypertension remains largely unknown and is an area of active research It appears to have multifactorial and complex etiology ... that several interrelated cellular and molecular processes such as inflammation are a likely consequence of mechanical and chemical damage of the endothelium by Target Organ Damage in Essential ... spirinolactone to an ACE inhibitor (enalapril/trandolapril) or ARB (candesartan) resulted in a greater decrease in LV mass and fibrosis than any of these drugs alone (Sato et al., 2002; Taniguchi et al.,...
  • 246
  • 484
  • 0
báo cáo khoa học: " Three-dimensional reconstruction of cell nuclei, internalized quantum dots and sites of lipid peroxidation" docx

báo cáo khoa học: " Three-dimensional reconstruction of cell nuclei, internalized quantum dots and sites of lipid peroxidation" docx

Ngày tải lên : 11/08/2014, 00:22
... during and after cell insults and pharmacological interventions are useful for correlations with cellular responses The nature of morphological changes and of spatial relationships among organelles ... again shown as a translucent surface, and the chromatin with intensities above a certain threshold is shown as blue boxes Additional files and contain the complete 3-D model and an animation of ... simple and suitable approach to 3-D reconstruction of intracellular QD location and of changes in nuclear morphology and lipid peroxidation as a consequence of oxidative stress [16,17,2833] The approach...
  • 19
  • 260
  • 0
Báo cáo y học: " Advances in the genetics and epigenetics of gene regulation and human disease" pps

Báo cáo y học: " Advances in the genetics and epigenetics of gene regulation and human disease" pps

Ngày tải lên : 14/08/2014, 17:22
... the mammalian enhancer elements, Hallikas and colleagues have developed a new computational tool (Enhancer Element Locator; available online [http://www.cs.helsinki.fi/u/kpalin/EEL/]), and used ... variety of human cancers, and are often associated with poor clinical outcome for the patient Target genes for amplified regions are often oncogenes, which may be used as therapeutic, prognostic and ... specific From the characteristic amplification profiles, Myllykangas showed that cancers with similar cellular origin and histology, such as breast and prostate adenocarcinomas, clustered together...
  • 3
  • 265
  • 0
Báo cáo khoa học: Theoretical study of lipid biosynthesis in wild-type Escherichia coli and in a protoplast-type L-form using elementary flux mode analysis potx

Báo cáo khoa học: Theoretical study of lipid biosynthesis in wild-type Escherichia coli and in a protoplast-type L-form using elementary flux mode analysis potx

Ngày tải lên : 22/03/2014, 21:20
... elongation of unsaturated fatty acids, and a knockout might result in overproduction of saturated fatty acids and reduced production of unsaturated fatty acids by FabA, leading to the lethality of ... FabD, FabH_2, FabB_3, and AccACD In this cycle, acetyl-CoA is carboxylated (driven by ATP hydrolysis) and decarboxylated again (Fig 2) The remaining EFMs are capable of producing all of the main ... of lipid A comprise 24 EFMs in the case of lipid A and 51 for lipid A (ca) In addition, there are a number of side EFMs forming lipid A [or lipid A (ca)] and, simultaneously, other products of...
  • 12
  • 553
  • 0
Tài liệu GENETICS IN PREVENTION AND TREATMENT OF CANCER ppt

Tài liệu GENETICS IN PREVENTION AND TREATMENT OF CANCER ppt

Ngày tải lên : 15/02/2014, 04:20
... 0" # ' A J 1114 !B=*!B, /" N : N S F "$ # * * ( ! ! O @ , -B*1 $ -/3 % " ' E $ # $ ! L + # ** $ $ %# ! @ !2 4- *B ,/C $ E7 K ' I K $ $ # # $* O> # $ @ - ! *2 /) 4! = A = -, ! 2/7 AA + F0 ... /) 4! = A = -, ! 2/7 AA + F0 + K ' O ' $ A = ( % ! = O @ != $ !! =-!B*=B 5($ C # ( $ ! =A # C ! " ( ' # ' J$* ' - & # $ $ ! =* /3 ) # "! = "( J ( A EA ED -2 B - 1, = # E +> " - B ## I # BB $ ... ($ > O A$ " P # 79 D0 ( " F ' )" * + ' * E$ "/ ! ! ! ! %" # , " & ' % ) # J 2!4 1-*11 > A '- C =/ Q % # )$ # $ # $ 1' " ' % ! = = = " =* B/ $ ' # # # ( C ! "' ! " " ! ! 2- ,-*2= /0 ' A ' E...
  • 12
  • 436
  • 0
Tài liệu Báo cáo khoa học: Peptides corresponding to helices 5 and 6 of Bax can independently form large lipid pores pdf

Tài liệu Báo cáo khoa học: Peptides corresponding to helices 5 and 6 of Bax can independently form large lipid pores pdf

Ngày tải lên : 19/02/2014, 07:20
... With LUVs made of PtdCho at lm lipid concentration, IC50 values are in the nanomolar range for Bax -a5 (Fig 4A, squares and continuous line), and about an order of magnitude higher for Bax -a6 (Fig ... ´ ´ A J Garc a- Saez et al A Large pores formed by Bax peptide fragments Table Effect of the lipid composition of LUVs on the release of calcein exerted by Bax -a5 and Bax -a6 Lipid mixtures are ... intrinsic ability to form toroidal pores, and this ability is present in at least two helical fragments of its structure Both the a5 and a6 fragments are amphipathic and have positively charged Lys and...
  • 11
  • 586
  • 0
Báo cáo khoa học: Molecular cloning and characterization of methylenedioxy bridge-forming enzymes involved in stylopine biosynthesis in Eschscholzia californica doc

Báo cáo khoa học: Molecular cloning and characterization of methylenedioxy bridge-forming enzymes involved in stylopine biosynthesis in Eschscholzia californica doc

Ngày tải lên : 07/03/2014, 10:20
... TCAAACAGTGGTAGGCGAGAGA CAATGGAGTTGGTGGGTGAA GAGATTAGTAGGAGTTGGGGTGAGA ATTGGAGGGATACTTTGTGGATG CCTAGAAGAGGAATCAGAACATCCA TCACTTCTCTCCCTTCCACCA GTCGTAATTAATCACTTAACCGTGCTCG GAAAGAAACAGAGCAAATCTTATCCTTTTACC ... 5¢-RACE, 5¢-GSP1 (5¢-GTTATGGTGTAAGGCATAAAGATTA ACCATAACC-3¢) and 5¢-GSP1 nested (5¢-TGTAAGGCA TAAAGATTAACCATAACCCTAGTACC-3¢) and 3¢RACE, 3¢-GSP1 (5¢-AATAAGGGTACTAGGGTTATGG TTAATCTTTATGC-3¢) and ... CAAAAGAAACTAGTAATGG-3¢) and reverse primer (5¢-ATACTAGTGCACGGTTAAGTGATTAATTACG-3¢) for CYP71 9A2 , and the forward primer (5¢-ATACTAGTA TGGAGGAGATGAAGTTCTTGATAATG-3¢) and reverse primer (5¢-ATACTAGTTATTAGTTACGAGGATTGAT...
  • 17
  • 376
  • 0
Báo cáo khoa học: Molecular cloning, expression and characterization of cDNA encoding cis-prenyltransferases from Hevea brasiliensis A key factor participating in natural rubber biosynthesis pdf

Báo cáo khoa học: Molecular cloning, expression and characterization of cDNA encoding cis-prenyltransferases from Hevea brasiliensis A key factor participating in natural rubber biosynthesis pdf

Ngày tải lên : 07/03/2014, 21:20
... (5¢-GCAAATGCAACTGGA AGCGG-3¢) and A1 (5¢-ACAGCCTGCTAGCAAAGA GG-3¢) for amplification of HRT1, and primers S2 (5¢-GAAGAATCCTCTAAGGATAA-3¢) and A2 (5¢-TA CAAGGATTAATCCCTTGC-3¢) for amplification of ... template and then sequenced Finally, two cDNAs were obtained and designated HRT1 and HRT2, respectively DNA sequencing analysis Materials and methods Plant materials and RNA isolation Latex and various ... AAM92890), AAM92881, AAM92879, BAB92023 (AAM92883, AAM92884, AAM92885, AAM92887, AAM92888), BAB92024 and AAM92882 (AAM92886) (submitted to GenbankTM and DDBJ by Coldren et al and Sando et al respectively)...
  • 10
  • 516
  • 0
Báo cáo Y học: Molecular cloning and characterization of isomultiflorenol synthase, a new triterpene synthase from Luffa cylindrica, involved in biosynthesis of bryonolic acid ppt

Báo cáo Y học: Molecular cloning and characterization of isomultiflorenol synthase, a new triterpene synthase from Luffa cylindrica, involved in biosynthesis of bryonolic acid ppt

Ngày tải lên : 08/03/2014, 23:20
... b-amyrin synthase [6], was prepared by PCR using GgbAS1 as a template, Taq DNA polymerase (Takara Shuzo, Kyoto, Japan), the primers 50 -GAAGCATA TCCACTATGAAGATGA-30 and 50 -TGAATACTCCCGTG ATTTCCTGTTG-30 ... Luffa cells by guanidine thiocyanate/hot phenol extraction [24] Poly (A) -rich RNA was purified by an mRNA purification kit (Pharmacia), and a Luffa cDNA library was constructed using a lZAP-cDNA synthesis ... with Pfu DNA polymerase (Stratagene) used as the DNA polymerase Two primers of 50 -CTGGTACCGATTGAGTTGAGGTG ATTG-30 (Kpn I site underlined) and 50 -CCTCTAGAGTA AAAGTCTCCAATC-30 (Xba I site underlined)...
  • 7
  • 491
  • 1
Báo cáo khoa học: Delineation of the roles of FadD22, FadD26 and FadD29 in the biosynthesis of phthiocerol dimycocerosates and related compounds in Mycobacterium tuberculosis pptx

Báo cáo khoa học: Delineation of the roles of FadD22, FadD26 and FadD29 in the biosynthesis of phthiocerol dimycocerosates and related compounds in Mycobacterium tuberculosis pptx

Ngày tải lên : 15/03/2014, 11:20
... fadD22C TCACGGGTCGCATCAAGGAGC fadD22J ACAACATATGCGGAATGGGAATCTAGC fadD22K ACAAAAGCTTCTTCCCAAGTTCGGAATCGA fadD26F CATAGTGAACGCCAGAAAGCCG fadD26G TAGGTAGTCGATTAGCCAGTGG fadD26K ACAACATATGCCGGTGACCGACCGTT ... fadD29E CCGACTCGGATTCGTATGAAAG fadD29F GTTATGCCATAGCATCTAGGC fadD29I ACTTCGCAATGAAAACCAACTCGTCATTTC 2949H ACTTCGCAATGACCGAGTGTTTTCTATCTG 2949I ACAAAAGCTTTATTGGATGACCGCCCTAG res1 GCTCTAGAGCAACCGTCCGAAATATTATAAA ... ACAACATATGCCGGTGACCGACCGTT fadD26L ACAAAAGCTTCATACGGCTACGTCCAGCC fadD2 9A GCTCTAGAGTTTAAACCGCGCTCGGGGTACCTGG fadD29B GCGCGGCCGCGTTTAAACCGATCGCGCAGCGCATC fadD29C TCGCGACGACGTGGAAGAGGC fadD29D ATCGGTTCGTAGCCTCCAGGC...
  • 11
  • 550
  • 0
Báo cáo khoa học: Dissection of LolB function – lipoprotein binding, membrane targeting and incorporation of lipoproteins into lipid bilayers potx

Báo cáo khoa học: Dissection of LolB function – lipoprotein binding, membrane targeting and incorporation of lipoproteins into lipid bilayers potx

Ngày tải lên : 23/03/2014, 05:22
... mLolB as standards The minimum amount of mLolB was found to be more than two-fold higher than that of LolB, indicating that the lack of acyl chains decreases LolB activity (kDa) 21.5 Membrane localization ... Because of the technical difficulty in preparing a large amount of LolA–[35S]Lpp complex, the nonlabelled LolA–Pal complex was obtained as a spheroplast supernatant after the LolA-dependent release ... the anti-AcrA serum This work was supported by grants to H.T from the Ministry of Education, Science, Sports and Culture of Japan 12 13 14 References Miyadai H, Tanaka-Masuda K, Matsuyama S &...
  • 9
  • 526
  • 0
Báo cáo khoa học: Adipophilin increases triglyceride storage in human macrophages by stimulation of biosynthesis and inhibition of b-oxidation doc

Báo cáo khoa học: Adipophilin increases triglyceride storage in human macrophages by stimulation of biosynthesis and inhibition of b-oxidation doc

Ngày tải lên : 23/03/2014, 10:21
... cycles of 30 s at 95 °C, 30 s at 55 °C, and 30 s at 72 °C Adipophilin mRNA levels were normalized to 28S rRNA (5¢-AAA CTCTGGTGGAGGTCCGT-3¢ and 5¢-CTTACCAAAAG TGGCCCACTA-3¢) Western blot analysis ... shown that adipophilin expression was greater in human atherosclerotic lesions than in healthy areas of the same artery and that the majority of adipophilin mRNA in atheromatous tissue was attributed ... equivalent of human adipophilin, has been analysed in murine fibroblasts and the results showed that ADRP stimulated lipid accumulation and lipid- droplet formation without induction of other adipocyte-specific...
  • 13
  • 349
  • 0
Genetics and Testicular Cancer: Division of Cancer Epidemiology and Genetics Clinical Genetics Branch doc

Genetics and Testicular Cancer: Division of Cancer Epidemiology and Genetics Clinical Genetics Branch doc

Ngày tải lên : 28/03/2014, 23:20
... Inheritance Patterns Autosomal Dominant Autosomal Recessive X-Linked Recessive Inheritance from Your Parents Aa Aa aa Aa aa aa Alleles: variant forms of the same gene (A a) ASCO Autosomal Dominant Inheritance ... – General Population American Cancer Society Examine testicles during a cancer-related checkup every three years for men older than age 20 and annually after age 40 American Academy of Family ... Inheritance Normal Affected male Unaffected female mutation carrier Each child of a person with a mutation has 50% chance of inheriting the mutation Even though the cancer may appear to “skip generations,”...
  • 45
  • 259
  • 0
Báo cáo khoa học: Effects of sphingomyelin, cholesterol and zinc ions on the binding, insertion and aggregation of the amyloid Ab1)40 peptide in solid-supported lipid bilayers ppt

Báo cáo khoa học: Effects of sphingomyelin, cholesterol and zinc ions on the binding, insertion and aggregation of the amyloid Ab1)40 peptide in solid-supported lipid bilayers ppt

Ngày tải lên : 30/03/2014, 11:20
... Journal compilation ª 2006 FEBS S Devanathan et al Factors affecting Ab binding in lipid bilayers Formation of lipid membranes and peptide incorporation Fig Schematic diagram of a PWR apparatus A ... The Authors Journal compilation ª 2006 FEBS S Devanathan et al Factors affecting Ab binding in lipid bilayers Table Optical parameters of lipid and peptide layers after amyloid b1)40 peptide (Ab) ... Devanathan et al Factors affecting Ab binding in lipid bilayers B Resonance shifts (mdeg) A Fig Binding and aggregation of Ab in a SM ⁄ cholesterol (1 : 0.35) bilayer (A) p-Polarized PWR spectra...
  • 14
  • 532
  • 0
Báo cáo khoa học: Accessory proteins functioning selectively and pleiotropically in the biosynthesis of [NiFe] hydrogenases in Thiocapsa roseopersicina docx

Báo cáo khoa học: Accessory proteins functioning selectively and pleiotropically in the biosynthesis of [NiFe] hydrogenases in Thiocapsa roseopersicina docx

Ngày tải lên : 31/03/2014, 01:20
... hydrogenase biosynthesis is affected specifically and/ or pleiotropically Materials and methods Bacterial strains and plasmids Strains and plasmids are listed in Table T roseopersicina strains were ... the transposon was inserted The sequences have been deposited with GenBank, accession numbers AY152822 (A) and AY152823 (B) (5¢-CTAGACACATGGACAAAAGA-3¢) primers and the 1441 bp PCR product was cloned ... primers were used to amplify the 949 bp PCR fragment carrying the hynD gene: HYDAZ04: 5¢-ATCGG GATACCGAGACACAT-3¢, HYDAZ05: 5¢-AATGGGT TGAACGAGAGTCG-3¢ First, this fragment was cloned into the...
  • 10
  • 475
  • 0