gene symbol samm50 sorting and assembly machinery component 50 homolog

Expression dynamics of the hepatic mitochondrial proteome of the sod2+  mouse in response to troglitazone administration

Expression dynamics of the hepatic mitochondrial proteome of the sod2+ mouse in response to troglitazone administration

Ngày tải lên : 12/09/2015, 11:08
... my Ph.D and life Professor Chung has always been positive, and he gave me many opportunities, supported and encouraged me in bad times And that was how I was touched by his sincerity and patience, ... cell and nucleus and bind to PPARγ with Kd around 40 nM (Lehmann et al., 1995) When liganded, this causes a conformational change of PPARγ and its heterodimer partner, retinoid X receptor (RXR) and ... encompasses chemical labelling and label-free mass-spectrometry-based proteomics and (iii) and protein-chipbased arrays There are advantages and disadvantages to both platforms and they are listed in...
  • 226
  • 1.8K
  • 0
Báo cáo Y học: Expression of the uncoupling protein 1 from the aP2 gene promoter stimulates mitochondrial biogenesis in unilocular adipocytes in vivo potx

Báo cáo Y học: Expression of the uncoupling protein 1 from the aP2 gene promoter stimulates mitochondrial biogenesis in unilocular adipocytes in vivo potx

Ngày tải lên : 31/03/2014, 15:20
... of subcutaneous white fat from young (A and B) and adult (C and D) control (A and C) and transgenic (B and D) mice (A) The depot is composed of unilocular and multilocular adipocytes Only multilocular ... biogenesis has been also explored both in the transgenic mice and in 3T3-L1 adipocytes differentiated in cell culture MATERIALS AND METHODS Animals and tissues Control C57BL/6J male mice and ... depletes adipocyte fat while upregulating UCP1, UCP2, and genes for enzymes of fatty acid oxidation On the other hand, genes for lipogenic enzymes, aP2, and the transcription factor PPARc were downregulated...
  • 10
  • 555
  • 0
microsomal epoxide hydrolase gene is a novel endogenous protectant against beta amyloid (1-42)-induced cognitive impairments in mice

microsomal epoxide hydrolase gene is a novel endogenous protectant against beta amyloid (1-42)-induced cognitive impairments in mice

Ngày tải lên : 12/06/2014, 15:50
... mEH gene deficiency and CHO (100mg/kg, i.p.) on the Y-maze performance (A) and novel object recognition performance (B after Aβ (1-42) infusion .21 Fig Effects of mEH gene deficiency and ... finding-, and drinking-latency, respectively], mEH (-/-)- [p
  • 54
  • 168
  • 0
Báo cáo y học: "Adverse effects of adenovirus-mediated gene transfer of human transforming growth factor beta 1 into rabbit knees" potx

Báo cáo y học: "Adverse effects of adenovirus-mediated gene transfer of human transforming growth factor beta 1 into rabbit knees" potx

Ngày tải lên : 09/08/2014, 01:21
... associated with rheumatoid arthritis and osteoarthritis by local gene delivery Other workers and ourselves have previously examined the effects of TGF-β1 gene transfer on matrix synthesis in ... muscle, including stimulation of glycosaminoglycan (GAG) release and nitric oxide synthesis, and enhancement of fibrogenesis and muscle edema These results suggest that, although TGF-β1 may have ... (B), (F), (J), and (N) High magnification (400 ×) images of (A), (E), (I), and (M) (100 ×), respectively (D), (H), (L), and (P) High magnification (400 ×) images of (C), (G), (K), and (O) (100...
  • 8
  • 314
  • 0
Nhp6p and med3p regulate gene expression by controlling the local subunit composition of RNA polymerase II

Nhp6p and med3p regulate gene expression by controlling the local subunit composition of RNA polymerase II

Ngày tải lên : 11/09/2015, 16:08
... bend DNA sharply and regulate gene expression (Travers, 2003) In Saccharomyces cerevisiae, Nhp6p is encoded by two highly homologous genes, NHP6A and NHP6B Nhp6ap and Nhp6bp are 92- and 98-residue ... promote assembly of specialized recombination complexes (Paull et al., 1993; Segall et al., 1994; Lavoie and Chaconas, 1994) and facilitate nucleosome assembly and disassembly in vitro (Bonne-andrea ... acetylation and methylation, serine phosphorylation and arginine methylation, play major regulatory roles in many genetic events such as transcriptional activation and elongation, silencing and epigenetic...
  • 203
  • 228
  • 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: roles in gene expression, hormone signaling and mRNA processing docx

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: roles in gene expression, hormone signaling and mRNA processing docx

Ngày tải lên : 16/02/2014, 14:20
... and target gene expression MLLs are critical for HOX gene regulation and embryonic development Homeobox genes are a group of evolutionarily conserved genes that encode transcription factors and ... regulators of HOX genes, which are key players in embryogenesis and development Because of their importance in gene regulation and disease, MLLs have been isolated from human cells and their protein–protein ... epigenetic regulators of diverse gene types associated with cell-cycle regulation, embryogenesis and development MLLs also interact with nuclear receptors (NR) and coordinate hormone-dependent gene...
  • 15
  • 607
  • 0
Tài liệu PCR-RFLP ANALYSIS OF BETA-LACTOGLOBULIN GENE IN MURRAH BUFFALOES pdf

Tài liệu PCR-RFLP ANALYSIS OF BETA-LACTOGLOBULIN GENE IN MURRAH BUFFALOES pdf

Ngày tải lên : 18/02/2014, 02:20
... conditions and reagent concentrations were:100pmole of each primer,2.5 units of Taq.DNA polymerase,1X PCR buffer(10mM Tris – HCL, pH 9.0, 50 mM KCL and 1.5 mM MgCl2), 150 mM of each dNTP and 50 ng ... was to amplify the b-lg gene locus and to find out polymorphism at b-lg gene locus by using RFLP in Murrah buffaloes sodium chloride was added, vortexed and spun down at 500 0 rpm for 15 at room ... Meignanalakshmi and Mahalinga Nainar genotyping beta-lactoglobulin in Sahiwal and Tharparkar catte breeds Milk protein genes might be useful as genetic marker and is a promising alternative...
  • 4
  • 568
  • 0
Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

Ngày tải lên : 18/02/2014, 16:20
... of fatty acid genes; UCP3; the cardiac-enriched GLUT4; and PDK-4, an indirect inhibitor of glucose oxidation Gene expression was normalized to 18S rRNA Mitochondrial isolation and respiration ... various cardiac metabolic genes Here, myocardial PPARa gene expression was reduced in females at baseline (P < 0.001 versus male controls) (Fig 2A) In parallel, expression of the genes encoding muscle-type ... palmitoyltransferase (mCPT1) and medium-chain acyl-CoA dehydrogenase (MCAD) (both PPARa target genes) was A B C D Fig Immunohistochemical analysis of phospho-Akt in male and female control (db ⁄...
  • 7
  • 582
  • 0
Tài liệu Báo cáo khoa học: Complex transcriptional and translational regulation of iPLA2c resulting in multiple gene products containing dual competing sites for mitochondrial or peroxisomal localization docx

Tài liệu Báo cáo khoa học: Complex transcriptional and translational regulation of iPLA2c resulting in multiple gene products containing dual competing sites for mitochondrial or peroxisomal localization docx

Ngày tải lên : 19/02/2014, 16:20
... conditions: at 50 °C and 10 at 95 °C, followed by a total of 40 twotemperature cycles (15 s at 95 °C and at 60 °C) For the generation of standard curves, serial dilutions of a cDNA sample were used and ... annealed: g50 (5¢-TATTAATCTGACTGTAGATATAT ATATATTACCTCCTTAGTAATGC-3¢) and random- ized control g50c (5¢-TTGATAGTTATCTATTACAG TCTTCTTAGATTGAAACAA-3¢), g177 (5¢-CATACAA ACATAATAAGATGTAAATGG-3¢) and control ... and mitochondrial lipid metabolism, chemical energy production and thermal energy generation in mammalian tissue which will further the understanding of the role of iPLA2s in energy storage and...
  • 16
  • 438
  • 0
Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf

Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf

Ngày tải lên : 19/02/2014, 18:20
... (SPase) The various type I SPases from Gram-negative and Gram-positive bacteria show clear differences concerning gene size, gene copy number and substrate specificity, despite the substantial sequence ... 26–54) 816.2 (+ 4) and 850. 2 (+ 4) represent the unmodified and the sulfonated peptide, respectively Two additional, fourfold charged peptides with m ⁄ z ¼ 855.67 (rmm: 3418.7) and with m ⁄ z ¼ ... cell culture flasks ( 150 cm2, 100 mL modified Hayflick medium) were collected, washed twice with phosphate buffer and the pellet suspended in mL lysis buffer (500 mm NaCl, 50 mm Tris ⁄ HCl pH 7.5,...
  • 9
  • 559
  • 1
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

Ngày tải lên : 21/02/2014, 15:20
... AD- and BD- constructs and were grown until D600  Each culture (1 mL) was transferred to a microcentrifuge tube and centrifuged for s The yeast pellet was dissolved in 100 lL of Z buffer and ... in ice, and the samples were subjected to 15% SDS/PAGE The gels were dried and autoradiographed A total of 100 hand-dissected pairs of testes were homogenized in the buffer containing 50 mM Tris/HCl, ... in both AD- and BD-vectors To assay interactions, different combinations of AD- and BDconstructs were cotransformed into SFY526 and HF7c yeast strains carrying lacZ or HIS3 reporter genes, respectively,...
  • 10
  • 464
  • 0
Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx

Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx

Ngày tải lên : 07/03/2014, 16:20
... the gene (a-RT1 and a-RT2; see Materials and methods) and an oligo(dT) primer With the combination of oligo(dT)/a-RT1 primers two 700 and 320 bp fragments were amplified both from embryos and ... proteins, and it contains a DNA binding domain conserved in two invertebrate developmental regulators, Erect Wing and P3A2 [17] Erect Wing is essential for the Drosophila myogenesis and neurogenesis ... singlestranded binding protein (mtSSB), and the catalytic (a) and accessory (b) subunits of the DNA polymerase c (Pol c) [24,25] Interestingly, the expression of the genes encoding mtSSB and Pol...
  • 11
  • 532
  • 0
Báo cáo Y học: Processing, stability, and kinetic parameters of C5a peptidase from Streptococcus pyogenes pptx

Báo cáo Y học: Processing, stability, and kinetic parameters of C5a peptidase from Streptococcus pyogenes pptx

Ngày tải lên : 08/03/2014, 16:20
... C5a fragment (VVASQLRANISHKDMQLGR, SQLRANISHKDMQLGR, and VVASQLRANISH) and NH2-terminal segment of the C5a peptidase (QTPDEAAE ETI and AEETIADDANDL) were synthesized as C-terminal amides on a Gilson ... E280, 0.1% ¼ (5690 W + 1280Y + 120S-S)/M, where W, Y, and S-S represent the number of Trp and Tyr residues and disulfide bonds, respectively, and M represents the molecular mass [11,12] Molecular ... peptide and then plotted as a function of time The identity of peptides was determined by NH2-terminal sequence- and mass spectral analysis Treatment of the QTPDEAAEETI and AEETIADD ANDL synthetic...
  • 13
  • 487
  • 0
Báo cáo khoa học: Involvement of NF-jB subunit p65 and retinoic acid receptors, RARa and RXRa, in transcriptional regulation of the human GnRH II gene pot

Báo cáo khoa học: Involvement of NF-jB subunit p65 and retinoic acid receptors, RARa and RXRa, in transcriptional regulation of the human GnRH II gene pot

Ngày tải lên : 16/03/2014, 10:20
... Differential effects of ligand-activated RARa and RXRa on the promoter activity of the hGnRH II gene in TE671 and JEG-3 cells In vivo effect of RARa and RXRa with their ligands, ATRA and 9-cisRA, on the ... the GnRH II gene TE671 JEG-3 ‡ ‡ ‡ No treatment Ligand-bound (RARαRXRα) dimer Fig Effects of ligand-activated RARa and RXRa on hGnRH II gene expression The effect of ligand-bound RARa and RXRa on ... regulation of the GnRH II gene 250 200 ♠ 150 * 100 * * cells, the application of both ATRA and 9-cisRA significantly down-regulated the promoter function to 61.8 ± 5.0% and 57.5 ± 3.3%, respectively...
  • 12
  • 399
  • 0
Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt

Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt

Ngày tải lên : 17/03/2014, 23:20
... the WD gene are indicated in Fig The four MREs are located in the proximal region of the WD gene promoter between )434 and +114, with MREa and MREe in the forward orientation, and MREc and MREd ... and MREd on WD gene promoter activity Trinucleotide mutations were generated in the core sequence of each MRE (Fig 1) and these WD gene promoter variants were fused to a luciferase reporter gene ... buffer (7 M guanidine/ HCl, 50 mM Tris/HCl pH 8.0, 50 mM dithiothreitol, mM EDTA, and 0.25% nonfat milk) for h at room temperature and renatured by incubation in 50 mM Tris/HCl pH 7.5, 100 mM...
  • 11
  • 628
  • 0
Báo cáo khoa học: Functional role of fumarate site Glu59 involved in allosteric regulation and subunit–subunit interaction of human mitochondrial NAD(P)+-dependent malic enzyme pptx

Báo cáo khoa học: Functional role of fumarate site Glu59 involved in allosteric regulation and subunit–subunit interaction of human mitochondrial NAD(P)+-dependent malic enzyme pptx

Ngày tải lên : 23/03/2014, 06:20
... that Arg67 and Arg91 are the ligands for fumarate binding The side chains of Arg91 and Arg67 form salt bridges with the carboxylate group of fumarate (Fig 1B) Site-directed mutagenesis and kinetic ... differences in Km,NAD and K0.5,Malate observed among the wild-type and E59 mutant enzymes, except for the E59D enzyme The Km,NAD and K0.5,Malate values of E59D were 2-fold and 4.4-fold higher, ... distribution of the wild-type and E59 mutants The sedimentation coefcients of 6.5 S and 9.0 S represented the dimer and tetramer, respectively, corresponding to molecular masses of 124 and 248 kDa The quaternary...
  • 12
  • 360
  • 0
Báo cáo khoa học: Succinate dehydrogenase flavoprotein subunit expression in Saccharomyces cerevisiae – involvement of the mitochondrial FAD transporter, Flx1p ppt

Báo cáo khoa học: Succinate dehydrogenase flavoprotein subunit expression in Saccharomyces cerevisiae – involvement of the mitochondrial FAD transporter, Flx1p ppt

Ngày tải lên : 23/03/2014, 07:20
... 5Bb) and showed no difference between fermentable and nonfermentable carbon sources We also constructed a double mutant, flx1D-lacZ, containing both the FLX1 gene deletion and the reporter gene ... yeast extract and yeast nitrogen base were obtained from Difco (Lawrence, KS, USA), and anti-HA and anti-rat peroxidase conjugated IgG were obtained from Roche (Basel, Switzerland) and Jackson ... genomes by phylogenetic footprinting Science 301, 71– 76 Kellis M, Patterson N, Endrizzi M, Birren B & Lander ES (2003) Sequencing and comparison of yeast species to identify genes and regulatory...
  • 15
  • 407
  • 0
Báo cáo khoa học: Glutamine stimulates the gene expression and processing of sterol regulatory element binding proteins, thereby increasing the expression of their target genes docx

Báo cáo khoa học: Glutamine stimulates the gene expression and processing of sterol regulatory element binding proteins, thereby increasing the expression of their target genes docx

Ngày tải lên : 28/03/2014, 22:21
... an SREBP target gene, and that the transcription of SREBP-1a gene is predominantly regulated by the general transcription factor Sp1 [11,12] We next compared the glutamineinduced gene expression ... GM130, and subsequently incubated with the Cy3-conjugated secondary antibody The cells were imaged for GFP-SCAP (B and E) or GM130 (C and F) Panels D and G are merged images of GFP-SCAP and the ... promotes SREBP activities and stimulates the gene expression of SREBP targets Results and Discussion Glutamine stimulates the promoter activities of SREBP targets More than 50 years ago, Eagle et...
  • 12
  • 537
  • 0
Báo cáo khoa học: The GxxxG motif of the transmembrane domain of subunit e is involved in the dimerization/oligomerization of the yeast ATP synthase complex in the mitochondrial membrane doc

Báo cáo khoa học: The GxxxG motif of the transmembrane domain of subunit e is involved in the dimerization/oligomerization of the yeast ATP synthase complex in the mitochondrial membrane doc

Ngày tải lên : 31/03/2014, 01:20
... DTIM11 was constructed by a PCR-based mutagenesis and the kanr gene was removed [23] The mutations 19A, G15L, G19L and C28S were introduced by a PCR mutagenesis procedure [24] into a plasmid pRS313 ... role and these interfaces will be more precisely studied by site-directed mutagenesis of the ATP20 gene encoding subunit g to identify the interaction domains between subunit g and subunits e and ... SDS-dissociated wild-type and mutant mitochondria were performed Figure shows that polyclonal antibodies against subunit e revealed the presence of subunit e and a 21.4-kDa band in e19A, eG15L and eG19L mutant...
  • 10
  • 550
  • 0
Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

Ngày tải lên : 20/06/2014, 01:20
... http://www.virologyj.com/content/5/1/125 On the other hand, mutant viruses in which the UL7 homologous genes of other alphaherpesviruses pseudorabies virus (PRV) and bovine herpesvirus (BHV-1) have been constructed and characterized ... kanamycin-resistant gene, FRT sequence, and 50 bp flanking of UL7 sequences on each side, were generated by PCR from pCR2.1 (Invitrogen) using the following primers: Materials and methods and 5'-CGCATCCGTCGGGAGGCCACAGAAACAAAACCGGGTTTATTTCCTAAAAT ... to avoid disrupting expression at neighboring loci, the UL6 gene overlaps with the UL7 gene and the UL8 gene is only 3' to the UL7 gene Therefore, we next examined whether or not deletion of...
  • 13
  • 463
  • 0