functional analysis of noncoding rnas in trypanosomes rna walk a novel approach to study rna rna interactions bet

A novel role of hydrogen sulfide in wound healing and a new approach to wound dressing in rat model

A novel role of hydrogen sulfide in wound healing and a new approach to wound dressing in rat model

Ngày tải lên : 26/09/2015, 09:39
... plotted as the fraction of original area after wounding The original wounded area at day is defined as 100 percent original area; the areas at day 3, and9 are calculated as the percentage of the ... Wound contractions plotted as the fraction of original area after wounding The original wounded area at day is defined as 100 percent original area, the areas at day 3, and are calculated as the ... of inflammation) increased in wounded skin, and PAG administration significantly reduced MPO activity in wounded skin compared to non-treated animals Histological analysis also revealed that aggregated...
  • 80
  • 424
  • 0
Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx

Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx

Ngày tải lên : 08/03/2014, 16:20
... AAATGAGCCCAACAAAGCCGAGAAAAACATT AATTTGATGCTCGACAGGCTGCCGCGGAGACATGG CAATCCGGGAGACAGCTGGTGATGAAAA TAGCCACACTTGCAGCCGCGGCCAAAAATG TTAATGGGGATGAGAGCGGTTGCCACTTTCT AGATGGGTTGGCAACTTTCGCTTCAAAA TGAAAACCGCCAGTGCTATTGCTGTGAACA ... TGAAAACCGCCAGTGCTATTGCTGTGAACA CCTGACAGCAACTACGCAGCGTTCTGTTCAG AGCAACTATCCACCGTTCGCTTCAGGGACTG TGCTTCATCTTGCTGACGTGTACGTGGGACT ATGTGTACGTGGGACTGGCACTTCGAAAGC AAAATGGCCTACAGTTTAGCTCGGTACC CAGAATCGCCAATGACATGTCAAGGAAGAAGCATCTGAGATGTTAGTCTAGATAT ... CAGAATCGCCAATGACATGTCAAGGAAGAAGCATCTGAGATGTTAGTCTAGATAT GTCAAGGAAGAAGCATCTGAGAGCCTAGTCTAGATAT named according to the amino-acid residues substituted by alanine and their respective position in the polypeptide...
  • 7
  • 404
  • 0
Báo cáo y học: " Large-scale analysis of chromosomal aberrations in cancer karyotypes reveals two distinct paths to aneuploidy" ppsx

Báo cáo y học: " Large-scale analysis of chromosomal aberrations in cancer karyotypes reveals two distinct paths to aneuploidy" ppsx

Ngày tải lên : 09/08/2014, 23:20
... related cancers, as has been the case for cytogentic aberrations The main challenges in adapting our methods for array-based data are assigning each sample with a set of aberrations (aka ‘aberration ... In this study we computationally analyzed a large number of cancer karyotypes from the Mitelman Database, the largest available compendium of cancer karyotypes Based on statistical analysis of ... leading source of information for clinicians who diagnose and treat cancer The large number of samples in the database makes it ideal for statistical analyses, which are capable of overcoming...
  • 12
  • 418
  • 0
Báo cáo y học: "Whole-genome analysis of mRNA decay in Plasmodium falciparum reveals a global lengthening of mRNA half-life during the intra-erythrocytic development cycle" pptx

Báo cáo y học: "Whole-genome analysis of mRNA decay in Plasmodium falciparum reveals a global lengthening of mRNA half-life during the intra-erythrocytic development cycle" pptx

Ngày tải lên : 14/08/2014, 07:22
... This internal control mix was added to each total RNA sample analyzed in the decay time course, as well as to the total RNA used as pool, at a final concentration of ng of each S cerevisiae RNA ... was inhibited and total RNA was harvested for microarray hybridization Transcriptional shut off was achieved by addition of actinomycin D (actD), which is known to intercalate into DNA and inhibit ... Given that mRNA decay is an integral component of gene expression regulation, we conducted a genome-wide study of mRNA decay in P falciparum using a microarraybased approach to measure mRNA half-life...
  • 12
  • 324
  • 0
Báo cáo khoa học: Molecular cloning and functional expression of the human sodium channel b1B subunit, a novel splicing variant of the b1 subunit potx

Báo cáo khoa học: Molecular cloning and functional expression of the human sodium channel b1B subunit, a novel splicing variant of the b1 subunit potx

Ngày tải lên : 16/03/2014, 23:20
... from an area of the oocyte equivalent to 20–25% of the total surface Voltage electrodes had resistances of 0.2–0.5 MW Custommade software and hardware were used for acquisition and analysis of data ... current amplitude of NaV1.2 Each individual data point in the histogram represents the peak inward current for a single oocyte Also shown are the mean (j) and standard deviation (bars) for each cRNA ... proteins initiating at amino acid 17 (alanine) The hydrophobic C-terminal region (residues 243–262) may serve as a transmembrane domain The estimated protein molecular mass was  30.4 and 28.9 kDa...
  • 9
  • 415
  • 0
Báo cáo y học: "α Does protein kinase R mediate TNF-α- and ceramide-induced increases in expression and activation of matrix metalloproteinases in articular cartilage by a novel mechanism" pps

Báo cáo y học: "α Does protein kinase R mediate TNF-α- and ceramide-induced increases in expression and activation of matrix metalloproteinases in articular cartilage by a novel mechanism" pps

Ngày tải lên : 09/08/2014, 01:23
... Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases and tissue inhibitors of metalloproteinases in synovial fluids from patients with rheumatoid arthritis ... and activation of MMPs, in the absence of a corresponding increase in their inhibitors, would shift the balance of homeostasis towards matrix catabolism AP-1, activator protein-1; eIF2α, eukaryotic ... penicillin and 10 µg/ml streptomycin In vitro cartilage samples Cartilage was taken from the metacarpophalangeal joint of 7-day-old bovine calves within 12 hours of slaughter using a scalpel and...
  • 10
  • 379
  • 0
Báo cáo y học: "A novel approach to measure the contribution of matrix metalloproteinase in the overall net proteolytic activity present in synovial fluids of patients with arthritis" pptx

Báo cáo y học: "A novel approach to measure the contribution of matrix metalloproteinase in the overall net proteolytic activity present in synovial fluids of patients with arthritis" pptx

Ngày tải lên : 09/08/2014, 08:22
... Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases and tissue inhibitors of metalloproteinases in synovial fluids from patients with rheumatoid arthritis ... of the MMP family is the hallmark of several inflammatory disorders, including arthritis MMP-9, in particular, has been implicated in the degradation and damage of articular cartilage in RA and ... Momohara S, Kashiwazaki S, Inoue K, Saito S, Nakagawa T: Elastase from polymorphonuclear leukocyte in articular cartilage and synovial fluids of patients with rheumatoid arthritis Clin Rheumatol...
  • 10
  • 494
  • 0
Báo cáo y học: " Corticomotor control of the genioglossus in awake OSAS patients: a transcranial magnetic stimulation study" pdf

Báo cáo y học: " Corticomotor control of the genioglossus in awake OSAS patients: a transcranial magnetic stimulation study" pdf

Ngày tải lên : 12/08/2014, 14:20
... participated to data collection and interpretation All authors participated in and helped to draft the manuscript All authors read and approved the final manuscript Additional material 10 Additional ... upper airway dilators Indeed, these muscles not only obey brainstem automatic respiratory commands but also in behavioral and voluntary commands, suprapontine in origin, that involve their somatotopic ... unloading [24], and the tonic activity of this muscle is also elevated in OSAS patients [15] This points to factors other than an increased reflex gain, as, for example, an increase in the respiratory-related...
  • 10
  • 428
  • 0
DETERMINANTS OF  EDUCATIONAL ATTAINMENT  IN EGYPT AND MENA: A  MICROECONOMETRIC  APPROACH

DETERMINANTS OF EDUCATIONAL ATTAINMENT IN EGYPT AND MENA: A MICROECONOMETRIC APPROACH

Ngày tải lên : 10/10/2014, 23:17
... TIMSS scale average  Scotland  Italy  Armenia  Norway  Ukraine  Jordan  Malaysia  Thailand  Serbia  Bulgaria  Israel  Bahrain  Bosnia and Herzegovina  Romania  Iran, Islamic Republic of Malta  Turkey  Syrian Arab Republic  ... Chapter 3. School Effects on Students Test Scores in Egypt  Kuwait, Saudi Arabia, Oman and Qatar, it is lower than Turkey, Israel, Iran, Dubai,  Lebanon, Jordan, Tunisia, Bahrain and Syria. In Sub‐Saharan African countries such  as Ghana and Botswana, students’ achievement in maths is behind that in Egypt.  ... Syrian Arab Republic  Cyprus  Tunisia  Indonesia  Oman  Georgia  Kuwait  Colombia  Lebanon  Egypt  Algeria  Palestinian National Authority  Saudi Arabia  El Salvador  Botswana  Qatar  Ghana  Science ...
  • 223
  • 400
  • 0
Managing and Practicing OD in an IT Environment - A Structured Approach to Developing IT Project Teams

Managing and Practicing OD in an IT Environment - A Structured Approach to Developing IT Project Teams

Ngày tải lên : 24/10/2013, 08:20
... team The database analysts and the programmers are unable to agree on the proper ways to pass information back and forth between the interface and the database, and the requirements analysts and ... packages), hardware and software implementation (implementing new computers or software), database management and revision (ensuring proper data storage and access), hardware and software upgrades ... in a measurable way IT and the projects that create it are going to be an increasingly integral part of modern life in the years to come Most organizations already depend upon a robust IT infrastructure...
  • 33
  • 567
  • 0
Tài liệu The New Face oF GoverNmeNT: How Public Managers Are Forging a New Approach to Governance pdf

Tài liệu The New Face oF GoverNmeNT: How Public Managers Are Forging a New Approach to Governance pdf

Ngày tải lên : 15/02/2014, 20:20
... identified, an in- depth analysis of the area and its antecedents is required GAO proposed five broad classes of investigation and sample questions for analysis in each of the 12 operational areas A transformation ... Failure or inability of an agency’s management or staff to adapt to changed conditions can also bring on a crisis Agencies often discover that they are in need of a transformation simply because ... organization has an incentive to deviate from the normal or approved behavior The unwillingness of managers or staff to accept change is often rooted in a culture of inertia and bureaucratic thinking...
  • 288
  • 2.4K
  • 0
Báo cáo hóa học: "Research Article A Novel Approach to the Design of Oversampling Low-Delay Complex-Modulated Filter Bank Pairs" doc

Báo cáo hóa học: "Research Article A Novel Approach to the Design of Oversampling Low-Delay Complex-Modulated Filter Bank Pairs" doc

Ngày tải lên : 21/06/2014, 19:20
... EURASIP Journal on Advances in Signal Processing delay can always be obtained that ranges below the group delay of a corresponding LP FIR filter However, the absolute minimum value of the passband ... upper inequality constraint is convex due to the linearity of the left term in h Please note that the number of constraints in the stopband in the original formulation is in nite regarding to the ... Advances in Signal Processing and secondly using the fact that in case of real-valued signals the real part in frequency domain corresponds to the even part in the time-domain [8]: (76) When applied...
  • 13
  • 623
  • 0
Báo cáo hóa học: " Research Article RRES: A Novel Approach to the Partitioning Problem for a Typical Subset of System Graphs" potx

Báo cáo hóa học: " Research Article RRES: A Novel Approach to the Partitioning Problem for a Typical Subset of System Graphs" potx

Ngày tải lên : 22/06/2014, 06:20
... consumed per invocation of the vertex at the edge’s head, in( ei ) According to the data rates at the edges, such a graph can be uniquely transformed into a single activation graph (SAG) in Figure ... rank levels are annotated at the bottom of the graphic The fundamental idea of the algorithm explained in Section is that, in general, a local optimal solution, for instance, covering the rank ... following equations: RT = Tlimit − Tmin , Ttotal − Tmin RA = Alimit , Atotal RS = Slimit Stotal (8) The totalised values for area Atotal , code size Stotal , and execution time Ttotal are simply...
  • 13
  • 310
  • 0
Báo cáo khoa học: "Preoperative Y-90 microsphere selective internal radiation treatment for tumor downsizing and future liver remnant recruitment: a novel approach to improving the safety of major hepatic resections" docx

Báo cáo khoa học: "Preoperative Y-90 microsphere selective internal radiation treatment for tumor downsizing and future liver remnant recruitment: a novel approach to improving the safety of major hepatic resections" docx

Ngày tải lên : 09/08/2014, 04:21
... Azekura K, Ueno M, Ohta K, Yamaguchi T, Matsubara T, Takahashi T, Nakajima T, Muto T, Ikari T, Yanagisawa A, Kato Y: Proliferative activity of intrahepatic colorectal metastases after preoperative ... Thai BL, Takayasu K, Takayama T, Kosuge T, Gunvén P, Yamazaki S, Hasegawa H, Ozaki H: Preoperative portal embolization to increase safety of major hepatectomy for hilar bile duct carcinoma: a ... Shimada R, Kubota M, Matsuyama Y, Nakayama A, Miyagawa S, Makuuchi M, Kawasaki S: Preoperative portal vein embolization: an audit of 84 patients Hepatology 1999, 29:1099-1105 Page of (page number...
  • 7
  • 384
  • 0
Báo cáo y học: "A novel approach to sonographic examination in a patient with a calf muscle tear: a case report" docx

Báo cáo y học: "A novel approach to sonographic examination in a patient with a calf muscle tear: a case report" docx

Ngày tải lên : 11/08/2014, 17:21
... returned to the clinic one week later complaining that the pain in his left calf area persisted and could be further aggravated by tiptoeing and weight bearing maneuvers Again, US examination in the ... muscle Am J Sports Med 1977, 5:191-193 Takebayashi S, Takasawa H, Banzai Y, Miki H, Sasaki R, Itoh Y, Matsubara S: Sonographic findings in muscle strain injury: clinical and MR imaging correlation ... guidance, a 21–gauge needle was inserted into the fluid collection area and 15 ml of serosanguinous fluid was aspirated (Figure 3) Dramatic pain relief was noted after aspiration An elastic stocking...
  • 4
  • 316
  • 0
Báo cáo khoa học: "A novel approach to inhibit HIV-1 infection and enhance lysis of HIV by a targeted activator of complement" docx

Báo cáo khoa học: "A novel approach to inhibit HIV-1 infection and enhance lysis of HIV by a targeted activator of complement" docx

Ngày tải lên : 12/08/2014, 04:21
... surface-like membrane cofactor protein (MCP), decay accelerating factor (DAF) and protectin (CD59), and the soluble factor H(fH) that can down-regulate complement activation at several stages of ... effective vaccines against HIV infection due to a number of issues Firstly, there have been several recent failures of potential vaccine candidates in clinical trials In 2003, two phase trials using ... necessary for B-cell activation and contributes to a prolongation of Bcell antigen receptor signaling Thus, CR2 plays an important role in B-cell activation and combines the innate and adaptive arms...
  • 4
  • 287
  • 0
Báo cáo khoa học: " A novel approach to inhibit HIV-1 infection and enhance lysis of HIV by a targeted activator of complement" doc

Báo cáo khoa học: " A novel approach to inhibit HIV-1 infection and enhance lysis of HIV by a targeted activator of complement" doc

Ngày tải lên : 12/08/2014, 04:22
... surface-like membrane cofactor protein (MCP), decay accelerating factor (DAF) and protectin (CD59), and the soluble factor H(fH) that can down-regulate complement activation at several stages of ... effective vaccines against HIV infection due to a number of issues Firstly, there have been several recent failures of potential vaccine candidates in clinical trials In 2003, two phase trials using ... necessary for B-cell activation and contributes to a prolongation of Bcell antigen receptor signaling Thus, CR2 plays an important role in B-cell activation and combines the innate and adaptive arms...
  • 4
  • 271
  • 0
Báo cáo y học: "A novel approach to identifying regulatory motifs in distantly related genomes" pps

Báo cáo y học: "A novel approach to identifying regulatory motifs in distantly related genomes" pps

Ngày tải lên : 14/08/2014, 16:20
... TCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGCGGA TCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGGGGG TCTGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGGGGG TCCGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGGGGG ... GTCCCCGCTCCCTCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG GTCCCCACTCCCTCTGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG GTCCCCACTCCCTCCGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG ... TCCGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGGGGG TAGCCCACGACAGCCAAATAATAATGAATCATTTCATAAATAATGGGTTTAGGGGCTTATCGGGA Rn Mm Pt Hs Fr GTCCCCGCTCCCTCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG GTCCCCGCTCCCTCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG...
  • 18
  • 389
  • 0
Probiotics as a novel approach to modulate incretins, insulin secretion and risk factors of type 2 diabetes and complications

Probiotics as a novel approach to modulate incretins, insulin secretion and risk factors of type 2 diabetes and complications

Ngày tải lên : 19/11/2015, 16:47
... GAC AGA ATG TAC ACT TCA 24 nt tuf-S CCA TCA AGC CGC ACA CCA AGT TCG 24 nt Lacto-F2 TGG AAA CAG ATG CTA ATA CCG 21 nt Lacto-R2 CGT CCA TTG TGG TAG ATT CCC T 22 nt Lacto-S CTG AGA CAC GGC CCA WAC ... to the randomization list The appropriate package was handed to the particular participant Statistical data analysis and power calculation Statistical data analysis and the power calculation were ... WAC TCC TAC GG 26 nt F_reut_IS ACC GAG AAC AAC GCG TTA TTT 21 nt R_reut_IS CAT AAC TTA ACC TAA ACA ATC AAA GAT TGT 30 nt P_reut_IS ATC GCT AAC TCA ATT AAT 18 nt Ampl Lit 159 bp (Yang et al., 2002)...
  • 105
  • 330
  • 0
Tài liệu Báo cáo khoa học: Functional analysis of the basic helix-loop-helix transcription factor DEC1 in circadian regulation ppt

Tài liệu Báo cáo khoa học: Functional analysis of the basic helix-loop-helix transcription factor DEC1 in circadian regulation ppt

Ngày tải lên : 19/02/2014, 16:20
... 5¢-terminus primer (one of 5¢-AAGCT TCACCATGTACCCTGCCCACATGTACCAAGTG TAC-3¢, 5¢-AAGCTTCACCATGCCGCACCGGCTC ATCGAGAAAAAGAG-3¢, 5¢-AAGCTTCACCATG GCAGTGGTTCTTGAACTTACCTTGAAGC-3¢ or 5¢-AAGCTTCACCATGATTGCCCTGCAGAGTGG ... DEC1:2–412 and BMAL1, two sets of primers (5¢-AAGC TTGAGCGGATCCCCAGCGCGCAACCACC-3¢ and 5¢-GCAGCAGGATCCTCTAGAGAGTTTAGTC TTTG-3¢ for FLAG-DEC1; and 5¢-GAATTCGGCGG ACCAGAGAATGGACATTTCCTCAACCATC-3¢ and ... CTTCACCATGGAGCGGATCCCCAGCGCGCAACC AC-3¢) and a 3¢-terminus primer (one of 5¢-TCTA GACTAGGAGCTGATCAGGTCACTGCTAGTGAAA TGG-3¢, 5¢-TCTAGACTACCCACTCGAGTGAGCGA AAGTCCGCTGG-3¢ or 5¢-TCTAGACTATTGACCTG TTTCGACATTTCTCCCTGACAGCTC-3¢)...
  • 11
  • 629
  • 0