from a small place
Báo cáo khoa học: Alternative binding proteins: Affibody binding proteins developed from a small three-helix bundle scaffold potx
... non-mammalian origin of affibody proteins was shown to be an advantage for diagnostic applications involving sandwich assays Exchanging one of the reagents in a classical two-antibody sandwich assay ... systems are also being investigated, including b-lactamase-based protein fragment complementation assay [15], staphylococcal display [16,17], microbead display [18] and ribosomal display (S Grimm and ... urinary bladder carcinomas and is a well-known target for immunotherapy via the monoclonal antibody trastuzumab (Herceptin) [52] Evaluated monovalent and divalent affibody protein constructs have...
- 9
- 307
- 0
Báo cáo y học: "Melatonin therapy to improve nocturnal sleep in critically ill patients: encouraging results from a small randomised controlled trial" doc
... collected from each patient at appropriately spaced intervals after the first oral dose All samples were taken from the arterial line, immediately centrifuged, and stored at -20°C until assay Plasma ... (64) Data are presented as mean (standard deviation) AUC(0–24), area under the concentration time curve between time and 24 hours; C(08), plasma concentration at a. m.; Cl/F, clearance/bioavailability ... 0.32 Primary analysis Bispectral index Secondary analysis RCSQ, Richards Campbell Sleep Questionnaire The main pharmacokinetic data are summarised in Table Plasma melatonin concentrations declined...
- 9
- 330
- 0
Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf
... anti-GST and anti-Flag (Sigma), and anti-PARP (Cell Signal) The ProteoExtract Subcellular Proteome Extraction Kit (Calbiochem, La Jolla, CA, USA) was used to extract proteins from mammalian cells according ... mRNA level is depicted as a ratio of DAPK-1 ⁄ s-DAPK-1 to actin (E, F) s-DAPK-1, DAPK-1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA quantification in colon carcinoma and rectal carcinoma ... GST–s-DAPK-1, which may mask the actual cleavage band (data not shown) The higher molecular mass protein band ( 54 kDa) might result from a covalent adduct resulting from ubiquitin-like modification;...
- 11
- 659
- 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
... CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT ... CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) 576/192 468/156 ... somewhat smaller on average than those in extracts from Artemia, and by way of comparison, small heat shock /a- crystallin proteins produced in transformed bacteria usually reside as oligomers similar...
- 10
- 495
- 0
Báo cáo khoa học: FH8 – a small EF-hand protein from Fasciola hepatica docx
... studies, an ORF corresponding to a 69 amino acid protein was isolated from a screen of an F hepatica cDNA bank [8] This protein was called FH8, because of its molecular mass of kDa, and was detected ... programs [41] We used CaM from R norvegicus, as X-ray crystallographic coordinates for both states, apo and Ca2+-loaded, were available The molecular model of TnC from M musculus (Protein Data Bank ... & Carmona C (1997) Proteinases secreted by Fasciola hepatica degrade extracellular matrix and basement membrane components J Parasitol 83, 1–5 Maizels RM & Yazdanbakhsh M (2003) Immune regulation...
- 14
- 356
- 0
Báo cáo khoa học: Functional dissection of a small anaerobically induced bZIP transcription factor from tomato pdf
... TACTCGAGATGTCACCTTTAAGGCAGAG-3¢ and 5¢-ATATCCATGGAAAATTTAAACAATCCTGATG-3¢ Abz1(1–44): 5¢-TATACTCGAGATGTCACCTTTAAG GCAGAG-3¢ and 5¢-ATATCCATGGGCTTCTTCATC CTCGATCGC-3¢ Abz1(1–24): 5¢-TATACTCGAGAT ... 5¢-TATACTCGAGAT GTCACCTTTAAGGCAGAG-3¢ and 5¢-ATATCCATG GTCTCATCCATTCCTGCATAC-3¢ Abz1(45–138): 5¢TATACTCGAGATGCAGAAGCTTCTGCAAGATTT GAC-3¢ and 5¢-ATATCCATGGAAAATTTAAACAA TCCTGATG-3¢ The XhoI and NcoI sites ... N-terminal deletion, ABZ1(47–138): 5¢-TATGGATCCATGC TTCTGCAAGATTTGACAGG-3¢ and 5¢-ATATCCC GGGTTAAAATTTAAACAATCCTG-3¢ C-terminal deletion, ABZ1(1–100): 5¢-TATAGGATCCATGTCACC TTTAAGGCAGAG-3¢ and 5¢-ATACCCGGGTTATAA...
- 11
- 536
- 0
Báo cáo khoa học: Characterization of novel sequence motifs within N- and C-terminal extensions of p26, a small heat shock protein from Artemia franciscana potx
... G 5¢-GGCACTTAACCCATGGTACATGGACCTTGATATTGAC-3¢ 5¢-GTCAATATCAAGGTCCATGTACCATGGGTTAAGTGCC-3¢ 5¢-GGACCTTGATATTGACGGTCCAGATACC-3¢ 5¢-GGTATCTGGACCGTCAATATCAAGGTCC-3¢ 5¢-GGATTGAAGGGGGAAGATCAGGAGGTGC-3¢ ... 11222–11228 11 Sun Y, Mansour M, Crack JA, Gass GL & MacRae TH (2004) Oligomerization, chaperone activity, and nuclear localization of p26, a small heat shock protein from Artemia franciscana J Biol Chem ... measurements is gratefully acknowledged The research was funded by a Natural Sciences and Engineering Research Council of Canada Discovery Grant, a Nova Scotia Health Research Foundation ⁄ Canadian Institutes...
- 14
- 358
- 0
Báo cáo y học: "Safety of rFVIIa in hemodynamically unstable polytrauma patients with traumatic brain injury: post hoc analysis of 30 patients from a prospective, randomized, placebo-controlled, double-blind clinical trial" pps
... recombinant activated factor VII Mil Med 2004, 169:16-18 41 Warren O, Mandal K, Hadjianastassiou V, Knowlton L, Panesar S, John K, Darzi A, Athanasiou T: Recombinant activated factor VII in cardiac ... 36:1001-1010 Maas AIR, Dearden M, Teasdale GM, Braakman R, Cohadon F, Iannoti F, Karimi A, Lapierre F, Murray G, Ohman J, et al.: EBIC guidelines for management of severe head injury in adults Acta Neurichir ... of recombinant activated factor VIIa Overall, rFVIIa is considered to have a favorable safety profile in hemophilia and in critical bleedings across a broad array of clinical scenarios [47-51]...
- 8
- 292
- 0
Financing a small business the ABC from star to fincne
... to offer longterm loans to smaller firms A Guaranteed Loan? • SBA and State Guarantee Programs are loans made by private lenders and guaranteed up to 85% by the federal or state government • The ... Loan State Administered Loan Programs • Nor-CAL FDC State Guarantee •Clean Loan Program (pollution & waste reduction) •Safe-Bidco State Guarantee •State Rural Loans- Agriculture & Industrial ... Costs • Working Capital • Real Estate SBA & State Guarantee Loans Small Business Administration • 7a Loan •Low-doc/Women & Minority Pre-qualification •504 Loan •SBA Micro loan •SBA Community Express...
- 43
- 153
- 0
How to setup a Linux system that can boot directly from a software RAID
... disks already contains data, make a backup if needed (all existing data of partitions involved in the process will be lost), and delete or resize existing partitions to create space for the software ... Minor RaidDevice State removed active sync /dev/hda1 Replacing the failed disk When a new disk to replace the failed one is available it can be installed into the system, partitioned to have the ... [root@fedora4 giotex]# mdadm manage /dev/md0 add /dev/hdc1 mdadm: hot added /dev/hdc1 [root@fedora4 giotex]# mdadm manage /dev/md1 add /dev/hdc2 mdadm: hot added /dev/hdc2 [giotex@fedora4 ~]$ cat...
- 14
- 567
- 1
John.Wiley.And.Sons.Marketing.Insights.From.A.To.Z.eBook-LiB.pdf
... stay relevant and few are sustainable Advantages are temporary Increasingly, a company wins not with a single advantage but by layering one advantage on top of another over time The Japanese have ... She added another value: that many women care about social issues and will patronize a company that cares.19 Greg Carpenter and Kent Nakamoto have challenged a core assumption of marketers that ... notion that a company wins by building a relevant and sustainable competitive advantage.17 Having a competitive advantage is like having a gun in a knife fight This is true, but today most advantages...
- 226
- 1,421
- 7
Immobilization of heavy metals in sediment dredged from a seaport by iron bearing materials
... premises Medical wastes include injurious medical wastes and common wastes Injurious medical wastes are medical wastes which contain factors that can harm man’s health and environment Those factors ... houses are non-standard, unsanitary and highly infectious In some areas, medical wastes are urgent matters because there have been no places for wastes to be gathered even in provincial hospital ... dumping waste bags to roadsides In particular, Hanoi has thousands of medical stations, making up about 2% of total wastes Only 60 hospitals and medical centers have signed up for waste treatment...
- 10
- 722
- 0
Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"
... (Years) All patients AVNRT AVRT EAT From symptom to ablation (Years) All patients AVNRT AVRT EAT RF-Applications (Number) All patients AVNRT AVRT EAT Examination time (Minutes) All patients AVNRT ... Abbreviations AVNRT: Atrio-Ventricular Nodal Reentry Tachycardia; AVRT: Atrio-Ventricular Reentry Tachycardia; AF: Atrial Fibrillation; EAT: Ectopic Atrial Tachycardia; F: French; INR: International Normalized ... defective (5) and insufficient (6) Y-axis: Percentage of patients Panel A: AVNRT Panel B: AVRT Panel C: EAT Comparing the categorical variables before and after ablation in AVNRT patients, applying...
- 9
- 679
- 0
A visit from a pen pal
... vùng; đ a phương to separate (v): ngăn cách; tách ra; chia Ex: Their yard is separated from the factory by a tall fence (Sân nhà họ ngăn cách với nhà máy hàng rào cao.) -» separate (adj): riêng ... eighth century (T a nhà trở thành nơi thờ phụng từ kỷ thứ tám.) -> to worship (v): thờ; thờ phụng; tôn thờ ASEAN (abbr) Association of South East Asian Nations: Hiệp hội nước Đông Nam Á Website học ... (into sth): chia, chia Ex: The teacher divided the class into small groups (Giáo viên chia lớp thành nhóm nhỏ.) -> division (n): phân chia; phép chia region (n): vùng; miền -» regional (adj): thuộc...
- 5
- 1,665
- 0
English Proverbs from A to Z
... time Good management is better than good income Great minds think alike Great oaks grow from little acorns Large successful operations can begin in a small way H Half a loaf is better than none ... to stop and accept a small loss, rather than continue and risk losing everything Better untaught than ill-taught It's better not to be taught at all than to be taught badly Birds of a feather flock ... appearances E Early to bed and early to rise makes a man healthy, wealthy and wise Easier said than done What is suggested sounds easy but it is more difficult to actually it Empty vessels make...
- 5
- 624
- 1
Unit 1: A visit from a pen pal
... Date of teaching: September 20th, 2006 Period: 06 Activity were a teacher ) b You live in a bike ( I wish I lived in a car ) Form : I wish + S + Past subjunctive + Ask students to look at the ... subjunctive + Ask students to look at the real situations and make wishes • Sample answers : a) I wish I were in the swimming pool now b) I wish I had a computer now c) I wish I lived close to ... d) I wish I drew well + Let students make three wishes of their own Practice Individual Homework - Do exercises / P 12 - Learn by heart the structures Remarks ...
- 2
- 1,081
- 0
Unit 1: A visit from a pen pal
... The past simple with wish + Give example and explain the way to use Ex : a You are a student ( I wish I were a teacher ) b You live in a bike ( I wish I lived in a car ) Form : I wish + S + Past ... visited * Cues : - Lang Biang Mountain / blimbing - Xuan Huong Lake / walk around - Valley of Love / sightseeing A : I think I’ll take my friends to ………….We can …… B : Good ideas ! I believe they will ... wish + S + Past subjunctive + Ask students to look at the real situations and make wishes • Sample answers : a) I wish I were in the swimming pool now b) I wish I had a computer now c) I wish I...
- 3
- 933
- 0
Unit 1_ A visit from a penpal
... Date: Name: _ English 9_ Unit Fill in each blank with one suitable word: Japan _four main islands Hokkaido, Honshu, Shikoku, and Kyushu A Japanese lunch is a light ... Communist north, and (REUNIFICATE) _occurred in mid-1975 Rewrite these sentences: Lan & her pen-pal, Maryam started corresponding over two years ago Lan & her pen-pal, Maryam have ... Democratic Republic of Vietnam (North Vietnam) and the former Republic of Vietnam (South Vietnam) Education in Vietnam is universal and _ for children ages to 11 The _language of...
- 4
- 552
- 0
Techical analysis from a to z
... technical analysis thirty years ago, many people considered technical analysis just another 1960's adventure into the occult Today, technical analysis is accepted as a viable analytical approach ... technical analysis thirty years ago, many people considered technical analysis just another 1960's adventure into the occult Today, technical analysis is accepted as a viable analytical approach ... money managers and home managers, students and strikers, doctors and dog catchers, lawyers and landscapers, and the wealthy and the wanting This breadth of market participants guarantees an element...
- 227
- 662
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25