for works carried out by the company itself with a credit to account 733
Tài liệu SPANISH GENERAL ACCOUNTING PLAN pptx
Ngày tải lên :
18/02/2014, 01:20
... the annual accounts 123 ABREVIATED FORMAT FOR ANNUAL ACCOUNTS 161 6.1 Abbreviated format for annual accounts 161 6.2 Content of the notes to the abbreviated annual accounts 167 CHART OF ACCOUNTS ... prepared applying the accounting standards and interpretations issued by the International Accounting Standards Board (IASB) In order for accounting standards drafted by a private organisation to ... International Accounting Standards (hereinafter adopted IAS/IFRS) The Regulation made it mandatory to apply these standards in the preparation of consolidated annual accounts by listed companies,...
- 366
- 498
- 0
Tài liệu Báo cáo khoa học: Is ATP binding responsible for initiating drug translocation by the multidrug transporter ABCG2? docx
Ngày tải lên :
18/02/2014, 18:20
... oxoanion vanadate serves as a transition state mimic, exploiting its chemical similarity to phosphate Thus, ATP and vanadate generate an ADP-vanadate structure mimicking the transition state for the ... order to maintain ABCG2R482G in a stable post-hydrolysis conformation, we employed the vanadate trapping procedure The data revealed that vanadate-trapped ABCG2R482G protein ([E]Æ[ADP]Æ[Vi]) remained ... photolabelled with [a3 2P]azido-ATP (3–300 lM) as described in Materials and methods Labelled protein was visualized and quantified by autoradiography of SDS-PAGE analysis The amount of bound protein was...
- 9
- 564
- 0
BRANDS ARE BUILT IN THE CONSCIOUSNESS OF THE RECEIVER, NOT BY THE COMPANY potx
Ngày tải lên :
09/03/2014, 00:20
... in particular can manage trees and forests in an ecologically sustainable way in a world of climate change.” The world’s forests today face a variety of threats “California and Australia are ... Finland’s Nokia, which surfed in on the IT wave and has maintained its hold at the top Together with the Japanese giant Toyota, the world’s largest automaker, these outsiders have broken the otherwise ... referring to the soap and shower gel made by the multinational Unilever For a long time, the brand stood for soap with added moisturizers But today the company stands for an alternative and more realistic...
- 36
- 485
- 0
MEALS ARE FREE UNLESS OTHERWISE NOTED: For additional listings provided by the Meals Partnership Coalition pot
Ngày tải lên :
22/03/2014, 21:20
... snack/coffee: Monday – Friday (8:00 AM – 10:00 AM) Breakfast: Monday and Wednesday (8:00 AM – 10:00 AM) Lunch: Tuesday and Friday (11:30AM – 12:30PM) Criteria: Open to all Please call first at the end ... Mary’s Place Breakfast: Monday – Friday (7:30 AM – 8:30 AM) Lunch: Monday – Friday (12:15 PM) Church of Mary Magdalene Breakfast: Saturday (9:00 AM) Lunch: Saturday (12:00 PM) Criteria: Open to ... (10:30AM – 1:00PM) Hmong Senior Club Group 5740 Martin Luther King Jr Way Seattle, WA 98118 Lunch: Wednesdays and Fridays (10:30AM – 1:00PM) Samoan American Pacific Organization Southgate Masonic...
- 15
- 358
- 0
Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx
Ngày tải lên :
18/02/2014, 08:20
... positions for Ab within the plasma membrane, as determined by experiments performed in vitro: one with Val24 at the membrane–water interface, the other with Lys28 at the interface [4,5] The location ... rat synaptic plasma membranes has shown that monomeric Ab can intercalate into the bilayer interior and lead to decreased bilayer thickness [7] The same study also concluded that Ab40 increased ... essential characteristics is appropriate here The coordinates and topology for the DPPC bilayer were obtained from a previous study by Tieleman and Berendsen [27], and are available at the author’s...
- 16
- 475
- 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
Ngày tải lên :
21/02/2014, 01:21
... together with oligonucleotides ECF-Q69G d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) ... and T Matsumoto for the analyses of iron and manganese in protein samples We also wish to thank H Steinman for the gift of E coli OX32 6A We finally thank Mr M Farrugia for photographic assistance ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG...
- 12
- 740
- 0
Báo cáo khoa học: Phosphorylation of the Saccharomyces cerevisiae Grx4p glutaredoxin by the Bud32p kinase unveils a novel signaling pathway involving Sch9p, a yeast member of the Akt / PKB subfamily pot
Ngày tải lên :
07/03/2014, 04:20
... exponential phase, and then incubated for 30 in galactose medium to activate the GAL regulon Total mRNAs were extracted and subjected to standard northern blot analysis GAL1 mRNA, and ACT1 mRNA (considered ... the same cellular lysate was incubated with the NiNTA matrix without any bound protein, and the sample was subjected to the same protocol Immune complex protein kinase assays The protein kinase ... its activation loop correlated with an increased activity on substrates, whereas all the mutant forms unable to autophosphorylate were also inactive on substrates [1– 3] A subsequent search for...
- 15
- 414
- 0
For Young Women Only by Shaunti Feldhahn and Lisa A. Rice potx
Ngày tải lên :
14/03/2014, 18:20
... Shaunti, who wrote For Women Only For that book, Shaunti did tons of research and data gathering about men that no one had done before Turns out, her Harvard graduate degree and years as a Wall ... explained a bunch of things that women just tend not to “get” about men, and it became a bestseller It’s been talked about on TV and radio, and Shaunti has had speaking engagements about it all across ... Street analyst helped pave the way for these well-researched books! We want to move you from the place of wishing certain things about guys to knowing the truth about them 2 Then there’s Lisa, a screenwriter,...
- 35
- 320
- 0
Báo cáo hóa học: " Reversal of TMS-induced motor twitch by training is associated with a reduction in excitability of the antagonist muscle" ppt
Ngày tải lên :
19/06/2014, 08:20
... limitation of the present study design was the lack of power to conduct a multi-factorial analysis that includes all the data (i.e., agonist and antagonist muscle data); therefore future studies with ... Stimulation, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA, USA 4MIT, Boston, MA, USA 5Institut Guttmann, Universitat Autonoma de Barcelona, Barcelona, Spain 6Laboratory ... contractions to become familiar with the experimental setup After each movement, we were able to monitor that the wrist returned to the start position by natural relaxation through visual feedback...
- 8
- 432
- 0
báo cáo hóa học:" A decade of modelling research yields considerable evidence for the importance of concurrency: a response to Sawers and Stillwaggon" potx
Ngày tải lên :
20/06/2014, 08:20
... so they were in general not concerned with richly parameterizing their model with behavioural and biological data in all of the ways that Sawers and Stillwaggon outline as necessary for a realistic ... The author thanks Aditya Khanna, Susan Cassels and the two anonymous reviewers for their valuable feedback and assistance with the manuscript Authors’ contributions SMG is responsible for all aspects ... relationships and momentary commercial contacts within or outside of these marriages They parameterized their model using behavioural data from South Africa, and after exploring a variety of scenarios,...
- 7
- 459
- 0
Báo cáo hóa học: "Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" pdf
Ngày tải lên :
22/06/2014, 22:20
... value is for indirect-gap materials Values of the optical band gap for the samples were obtained by the extrapolation of the linear region of the plot of (ahv)1/2 against photon energy (hv) as shown ... approach to band gap calculation is not particularly accurate for polydisperse solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band ... promote the decomposition reaction of metal alkyl xanthates, thiocarbamates and thiocarbonates at relatively low temperatures Indeed, the heating of the reaction mixture without amines at elevated...
- 5
- 365
- 0
Báo cáo hóa học: " Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" ppt
Ngày tải lên :
22/06/2014, 22:20
... value is for indirect-gap materials Values of the optical band gap for the samples were obtained by the extrapolation of the linear region of the plot of (ahv)1/2 against photon energy (hv) as shown ... approach to band gap calculation is not particularly accurate for polydisperse solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band ... promote the decomposition reaction of metal alkyl xanthates, thiocarbamates and thiocarbonates at relatively low temperatures Indeed, the heating of the reaction mixture without amines at elevated...
- 5
- 276
- 0
Báo cáo toán học: "On the Generalized Convolution with a Weight - Function for Fourier, Fourier Cosine and Sine Transforms" pot
Ngày tải lên :
06/08/2014, 05:20
... convolution with a weightfunction for the Cosine - Fourier integral transform, Acta Math Vietnam 29 (2004) 149–162 15 Nguyen Xuan Thao and Nguyen Thanh Hai, Convolution for Integral Transforms and Their ... Their Application, Russian Academy, Moscow, 1997 16 Nguyen Xuan Thao and Trinh Tuan, On the generalized convolution for I transform, Acta Math Vietnam 28 (2003) 159–174 17 M Saigo and S B Yakubovich, ... Kim Tuan, A new convolution theorem for the Stieltjes transform and its application to a class of singular equations, Arch Math 64 (1995) 144–149 20 E C Titchmarch, Introduction to the Theory of...
- 16
- 336
- 0
Báo cáo toán học: "A Pairing Strategy for Tic-Tac-Toe on the Integer Lattice with Numerous Directions" pot
Ngày tải lên :
07/08/2014, 15:22
... By using a strategy stealing argument [1], it can be shown that in all strong positional games, either Player has a winning strategy or the game is a draw Thus, it is reasonable to consider an ... an alternate positional game in which it is possible for Player to have a winning-strategy One such game is the Maker–Breaker game A Maker–Breaker positional game is where the first player, Maker, ... based on a pairing-strategy given by Hales and Jewett [1], [2] for the tic-tac-toe game played on Z × Z with the four standard directions They tile the integer lattice with the × direction assignment...
- 6
- 479
- 1
Báo cáo toán học: "Potential-Based Strategies for Tic-Tac-Toe on the Integer Lattice with Numerous Directions" potx
Ngày tải lên :
08/08/2014, 11:20
... turn i and remains a small set for the duration of the game, and we call A an ancestor of S We note that a small set may have many ancestors, but we will stipulate that there are not repeated edges ... that for a finite hypergraph H, if A H 2− |A| < , then o Breaker has an explicit winning strategy for the Maker–Breaker game played on H For an arbitrary sub-board B, consider the game played on the ... people are aware that × tic-tac-toe is a draw game By using a strategy stealing argument (see [1] for a description), it can be shown that in all strong positional games, either Player has a winning...
- 15
- 241
- 0
Báo cáo khoa học: " Postoperative Chemoradiation for Resected Gastric Cancer - Is the MacDonald Regimen Tolerable? A Retrospective Multi-Institutional Study" pptx
Ngày tải lên :
09/08/2014, 09:21
... collected the data, analyzed the data and wrote the paper OP: Designed the research, collected the data, analyzed the data and wrote the paper.EI: Collected the data KL: Collected the data.SM: Collected ... peritoneal if the tumor was detected in the peritoneal cavity; and distant in case of liver metastasis or metastases outside the peritoneal cavity Statistical analysis OS was defined as the time ... Collected the data.SK: Collected the data.NK: Collected the data.RMP: Wrote the paper BN: Collected the data.EF: Collected the data and wrote the paper AS: Wrote the paper BB: Designed the research, analyzed...
- 32
- 509
- 0
Báo cáo y học: "Diabetic ketoacidosis complicated by the use of ecstasy: a case report" ppsx
Ngày tải lên :
11/08/2014, 03:21
... reveal bacteria; arterial blood gas measurement revealed clinically important metabolic acidosis (Table 1); and lactate was in the normal reference range The patient received immediate intravenous ... mEq/L Anion gap 30.9 21.6 peritoneal irritation Her temperature was 37.3°C and the chest X-ray was normal Urine analysis showed pronounced ketonuria and an absence of pyuria; a urinary bacterioscopy ... classified as a hallucinogenic amphetamine [6] The drug acts primarily by promoting a massive release of serotonin from the presynaptic cleft and, additionally, inhibits serotonin reuptake and...
- 3
- 399
- 0
Báo cáo y học: "Diabetic ketoacidosis complicated by the use of ecstasy: a case report." docx
Ngày tải lên :
11/08/2014, 07:20
... reveal bacteria; arterial blood gas measurement revealed clinically important metabolic acidosis (Table 1); and lactate was in the normal reference range The patient received immediate intravenous ... mEq/L Anion gap 30.9 21.6 peritoneal irritation Her temperature was 37.3°C and the chest X-ray was normal Urine analysis showed pronounced ketonuria and an absence of pyuria; a urinary bacterioscopy ... classified as a hallucinogenic amphetamine [6] The drug acts primarily by promoting a massive release of serotonin from the presynaptic cleft and, additionally, inhibits serotonin reuptake and...
- 3
- 327
- 0
Báo cáo y học: "Inhibition of NFκB by the natural product Withaferin A in cellular models of Cystic Fibrosis inflammation" pps
Ngày tải lên :
11/08/2014, 08:22
... infection and these cells release proteases and other agents that cause structural damage to the airways Anti-inflammatory agents are used to manage lung inflammation in CF, but have adverse effects ... us to Withaferin A (WFA), a steroidal lactone isolated from the herb Withania somnifera (also known as Indian Ginseng and Ashwagandha), which is widely used in traditional Indian medicine as an ... Gunaherath GM, Shirahatti N, Mahadevan D, Gunatilaka AA, Whitesell L: Actin microfilament aggregation induced by withaferin A is mediated by annexin II Nat Chem Biol 2006, 2:33-38 Jayaprakasam B,...
- 5
- 306
- 0
báo cáo khoa học: " The changing trends in tobacco smoking for young Arab women; narghile, an old habit with a liberal attitude" ppt
Ngày tải lên :
11/08/2014, 18:20
... 12(6):606-612 Dar-Odeh NS, Bakri FG, Al-Omiri MK, Al-Mashni HM, Eimar HA, Khraisat AS, Abu-Hammad SM, Dudeen AA, Abdallah MN, Alkilani SM, Al-Shami L, AbuHammad OA: Narghile (water pipe) smoking among ... Rahman S, Almutawa A ASB, Al-Bedah AM, Al-Rabeah AM, Ali Bahaj A, El-Awa F, CW JN, Asma S: Prevalence of tobacco use among students aged 13-15 years in Health Ministers’ Council/Gulf Cooperation ... that females opt for the narghile and they so unacceptably at the young age of early adolescence Exposure to any form of tobacco at young age is expected to increase the risk of tobaccoassociated...
- 4
- 316
- 0