0

for the irrecoverable part of the loan with a credit to account 242

Tài liệu Essential Skills for the Agile Developer: A Guide to Better Programming and Design pptx

Tài liệu Essential Skills for the Agile Developer: A Guide to Better Programming and Design pptx

Hệ điều hành

... work together to make software that is readable, scalable, maintainable, and elegant In addition to these individual authors and thought leaders, we also want to acknowledge the thousands of students ... don’t want to test them We want to be able to refactor them (even eliminate them) and have the same tests pass as before we refactored • We need to test them individually, as a practical matter ... processLargeTransaction(), and processSmallTransaction()) are not part of the API of the object but are simply the functional steps along the way They are often called “helper methods” as a result For...
  • 262
  • 1,467
  • 1
Báo cáo hóa học:

Báo cáo hóa học: " Phase I clinical trial of the vaccination for the patients with metastatic melanoma using gp100derived epitope peptide " pot

Hóa học - Dầu khí

... responses against the melanoma Thus the further development of this agent to be used as an immunogenic antigen in vaccine related therapies against melanoma is warranted Abbreviations ALT: alanine aminotransferase; ... Kimura A, Kato H, Sasazuki T: DNA typing of the HLA -A gene: population study and identification of for new alleles in Japan Tissue Antigens 1996, 47:93-101 24 Imanishi T, Akaza T, Kimura A, Tokunaga ... article as: Baba et al.: Phase I clinical trial of the vaccination for the patients with metastatic melanoma using gp100-derived epitope peptide restricted to HLA -A* 2402 Journal of Translational Medicine...
  • 12
  • 396
  • 0
báo cáo hóa học:

báo cáo hóa học:" Validation of the Individualised Neuromuscular Quality Of Life for the USA with comparison of the impact of muscle disease on those living in USA versus UK" doc

Hóa học - Dầu khí

... myotonias and inflammatory myopathies Quantitative data The percentage of UK and US patients scoring some impact (i.e scoring to for extent of impact), or no impact (scoring 1) for each of the ... MD These included a) planning; “Because of the condition it is not easy to things on the spur of the moment It is not always practical to go to places that are new to me without a bit of forward ... is made up of a variety of individual diseases each of which may each be rare It is reasonable to study them collectively as all MD may have common symptoms of weakness, fatigue, or pain and...
  • 38
  • 391
  • 0
Creating 3D Game Art for the iPhone with Unity Part 1 docx

Creating 3D Game Art for the iPhone with Unity Part 1 docx

Kỹ thuật lập trình

... on the platform With the iOS, there is a handful of devices my game can be targeted for, and although internal hardware between the devices such as the iPhone and iPad differ, for the most part, ... Rauscher, the creator of Pano2VR, thank you for providing me a copy of Pano2VR for the book I greatly appreciate it! To Yazan Malkosh, thank you for your support on this book You are an amazing 3D artist, ... backed with a massive marketplace With the invention of the App Store, Apple established a mass market for developers to publish and sell content, which continues to rapidly expand each day At...
  • 28
  • 421
  • 0
Creating 3D Game Art for the iPhone with Unity Part 2 docx

Creating 3D Game Art for the iPhone with Unity Part 2 docx

Kỹ thuật lập trình

... that I determined to be the most important areas of the mesh These selected areas are the parts that will be deformed the most when Tater is rigged and animated and are the areas that I paid particular ... the amount of RAM of the iPad and 3GS at 512 MB while both the 3GS and iPad contain only 256 MB It’s important to understand the RAM available and what you have to work with The entire amount of ... Penelope model and making note of how many instances of Penelope I was able to add to the scene before it began to choke, I was able to get a good estimate of what the hardware could handle This...
  • 28
  • 339
  • 0
Creating 3D Game Art for the iPhone with Unity Part 3 ppsx

Creating 3D Game Art for the iPhone with Unity Part 3 ppsx

Kỹ thuật lập trình

... UVs and arranged the UV shells into their final positions for the map I also had to a few manual projections, relax the UVS using the Relax tool, and sew the shells together to eliminate seams ... section, we are going to discuss texture formats as they relate to the iDevice hardware These formats pertain to the formatting of the texture in system memory There are several formats that are supported ... was just a matter of painting in the hair I would frequently change the Scatter and Jitter settings to create a sense of randomness and variation in the hair Adding Some Wear and Tear Once the...
  • 28
  • 273
  • 0
Creating 3D Game Art for the iPhone with Unity Part 4 ppt

Creating 3D Game Art for the iPhone with Unity Part 4 ppt

Kỹ thuật lập trình

... character The next step was to sketch out the layout of the level so that when the time comes for actual modeling, I’ll have a diagram to follow All of the trial and error of the design and layout ... design phase rather than the finished model phase It’s always easier to realize device limitations and that a particular idea won’t work in the design phase rather than the finished model phase As ... specific and proportional section of the texture atlas Again, you’re not wasting any resolution, and the texture coordinates map to the specific area of the atlas, which directly relates as a to relationship...
  • 28
  • 390
  • 0
Creating 3D Game Art for the iPhone with Unity Part 5 pot

Creating 3D Game Art for the iPhone with Unity Part 5 pot

Kỹ thuật lập trình

... has been adjusted so that the X-axis is used to bend the arm at the elbow at a natural angle, which means the X-axis has been aligned parallel to the forearm Again, it’s important that all of ... Blender 2.5 has an Auto-Normalize feature to balance any overlapping weights to a total value of 1.0 as Maya does automatically It can be activated in the tool menu, by pressing the T-key while ... Rotations After the bones are created, you need to adjust the bone rotations so the €axes€are aligned correctly The goal is to make sure that all of the bones€are rotating in the same axis For example,...
  • 28
  • 395
  • 0
Creating 3D Game Art for the iPhone with Unity Part 6 pptx

Creating 3D Game Art for the iPhone with Unity Part 6 pptx

Kỹ thuật lập trình

... want to be aware of when exporting the scene Remember, my workflow has been to create all of the animations as separate Actions in the Action Editor and then select the appropriate Action before ... IK for Legs The first thing I needed to was to add another bone to the foot area that would act as the main controller for the leg and foot I selected the tail of the Foot Bone and aligned the ... 6.23 The purpose of this constraint is to allow me to have one control to move the arm as well as rotate the hand Since the Hand.L Bone is parented to the Forearm.L Bone, it will automatically...
  • 28
  • 314
  • 0
Creating 3D Game Art for the iPhone with Unity Part 7 pps

Creating 3D Game Art for the iPhone with Unity Part 7 pps

Kỹ thuật lập trình

... choose to bake the animation values to a key on each frame Essentially, this is taking the interpolation out of the animation curve by placing an exact keyed value at each frame in the animation ... on the Shoot Variable, Which Is of the AnimationState Data Type First, a private variable data typed as AnimationState is created to hold the shoot animation Next the shoot clip is set to the ... top of another The run animation will gradually decrease as the shoot animation is “faded in.” However, this isn’t what I’m particularly looking to do, as I want the shoot animation to play as the...
  • 28
  • 354
  • 0
Creating 3D Game Art for the iPhone with Unity Part 8 potx

Creating 3D Game Art for the iPhone with Unity Part 8 potx

Kỹ thuật lập trình

... bake and allow you to quickly see the map applied to the geometry The Quality will also adjust the Final Gather rays that are sent into the scene The more the rays are shot out into the scene, the ... Much to High with a total of 56 frames for the entire animation In Fig 7.43, you can see the trimmed animation and that the Timeline as been set to start at frame€0 and end at frame 56 At this ... created and the longer the baked animation will be So, what we need to is hit the P key to start the game, immediately hit the Spacebar, and as soon as enough of the animation we 180 Animation...
  • 28
  • 359
  • 0
Creating 3D Game Art for the iPhone with Unity Part 9 ppsx

Creating 3D Game Art for the iPhone with Unity Part 9 ppsx

Kỹ thuật lập trình

... and used a combination of a smaller version of the grime brush and the eraser tool to create dirt accumulation around the edges of the walls and areas where the barrels were stacked in corners ... 8.33, you can see the secondary dirt layer FIG 8.33╇ The Secondary Dirt Layer Was Used to Create Accumulation in the Corners and at the Base of the Walls In Photoshop, you can then adjust the strength ... in terms of performance to use Unity’s NVIDIA PhysX Engine This would shift the workload over to the more capable CPU rather than the GPU and can be an alternative to the baked animation method...
  • 28
  • 352
  • 0
Creating 3D Game Art for the iPhone with Unity Part 10 docx

Creating 3D Game Art for the iPhone with Unity Part 10 docx

Kỹ thuật lập trình

... hit, dispatches a message to play the attached animation for the FBX take file and instantiate a particle Prefab for the explosion at the position of the target FIG A. 25╇ This image shows the explosion ... Tater to a final drawing that would match my overall idea for the character Warner and I had a lot of fun developing Tater We had a lot of creative discussions, and it was really cool to see an ... Tater’s Â�Training Trash Yard FIG A. 24╇ The target was also made into a Prefab It consists of several small mesh items, a baked animation and Colliders There is also a script on the target, which...
  • 21
  • 195
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Variation in the phenology of shoot elongation between geographic provenances of maritime pine (Pinus pinaster) - implications for the synchrony with the phenology of the twisting rust fungus" potx

Báo cáo khoa học

... 1992) as The cummulative degree-day values were always calculated from January of each year Statistical analysis Calendar days and the different heat sums, obtained with the aforementioned formula, ... distribution of intra-group variances Infection percentages were analysed using a generalization of the analysis of variance adapted to categorical data analysis (CATMOD procedure of SAS) A log-linear ... coefficients of variation (CV), ie the ratio of the mean to the standard deviation of these values, were then calculated The approach using the standard error of prediction is based on the comparison...
  • 16
  • 417
  • 0
báo cáo khoa học:

báo cáo khoa học: "Analysis of the recurrence risk factors for the patients with hepatocellular carcinoma meeting University of California San Francisco criteria after curative hepatectomy" pot

Báo cáo khoa học

... transplantation for hepatocellular carcinoma in cirrhotic patients: a critical factor American Journal of Transplantation 2010, 10:129-137 20 Sakata J, Shirai Y, Wakai T, Kaneko K, Nagahashi M, Hatakeyama ... Ichida T, Makuuchi M, Matsuyama Y, Nakanuma Y, Okita K, Omata M, Takayasu K, Yamaoka Y: Reevaluation of prognostic factors for survival after liver resection in patients with hepatocellular carcinoma ... Wakai T, Shirai Y, Yokoyama N, Nagakura S, Hatakeyama K: Hepatitis viral status affects the pattern of intrahepatic recurrence after resection for hepatocellular carcinoma European Journal of...
  • 6
  • 337
  • 0
báo cáo khoa học:

báo cáo khoa học:" Validation of the Individualised Neuromuscular Quality Of Life for the USA with comparison of the impact of muscle disease on those living in USA versus UK" doc

Báo cáo khoa học

... of the residuals was examined to test for local independence The variance explained by the Rasch measures for the empirical calculation should be comparable to that of the model (>50% for an acceptable ... scale Although the raw variance explained by the PCA of the residuals was adequate (64.2%), the unexplained variance in the first contrast of the residuals was 3.9, suggesting the existence of a ... data available, respondents and non-respondents seemed no different However, too limited data was available for non-responders to allow for a statistical comparison Ethical approval was obtained...
  • 22
  • 484
  • 0
Báo cáo y học:

Báo cáo y học: " Identification of restriction endonuclease with potential ability to cleave the HSV-2 genome: inherent potential for biosynthetic versus live recombinant microbicides" pdf

Báo cáo khoa học

... instance, the P23 promoter from Lactococcus lactis created by PCR amplification with the primers 5'-GTGGAGCTCCCCGAAAAGCCCTGACAACCC-3' and 5'GGAAACACGCTAGCACTAACTTCATT-3', as described by Liu et al., ... Streptococcus gordonii, Lactobacillus paracasei and Staphylococcus carnosus [41-45] Assuming that this approach can be used to anchor the HSV-2 surface receptor on their cell walls, these bacteria ... EcoRII in Lactobacillus that also expresses a truncated recombinant form of the receptor nectin-1 (xREPLAB-tN1) The former are nanoparticles that may be explored to develop a model combinational microbicide,...
  • 12
  • 376
  • 0
Franklin Road Academy Prepares for the Future With ADC’s CopperTen® 10-Gigabit Cabling

Franklin Road Academy Prepares for the Future With ADC’s CopperTen® 10-Gigabit Cabling

Phần cứng

... 20 years Head of School Dr Margaret (Sissy) Wade charged Compton and other FRA IT staff with the task of technology planning and project management for the new cabling system Compton’s team designed ... renovation of the upper school building that houses humanities and social studies, and the south campus that houses foreign language classrooms At the same time, planning began for a new state -of -the- art ... the overall size of FRA to more than 330,000 square feet of learning space “Our ultimate goal is to be able to broadcast using video over IP from any space on campus For example, if we want the...
  • 4
  • 336
  • 0
Sexuality for the Man With Cancer doc

Sexuality for the Man With Cancer doc

Sức khỏe giới tính

... Colostomy: A Guide (also available in Spanish) Ileostomy: A Guide Urostomy: A Guide Laryngeal and Hypopharyngeal Cancer (also available in Spanish) Nasal Cavity and Paranasal Sinuses Cancer Oral ... you may need a loan from one of the others to balance your account Try to be aware of the costs of cancer in your life Make a special effort to get new deposits for the accounts that remain active ... Cavity and Oropharyngeal Cancer Salivary Gland Cancer (also available in Spanish) Sarcoma – Adult Soft Tissue Cancer (also available in Spanish) Books The following books are available from the...
  • 56
  • 413
  • 0
Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot

Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot

Báo cáo khoa học

... GTTAGTAGGTGAGAAATCGGCGGTTCAGTTTAACAGCAACA TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTGGCCTGAACCCACGATTTCTC TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA ... GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA TCTGCCCCTGGAGCCCTGCCCCA TGGGGCAGGGCTCCAGGGGCAGA CCTCGTCCTGCCGCCTCCAATGCTCTGGA TCCAGAGCATTGGAGGCGGCAGGACGAGG GCTCTGGAGCCTGACGCCAAGGCTCTGAGTATTGC GCAATACTCAGAGCCTTGGCGTCAGGCTCCAGAGC ... b-DG(654–750), and Asat and A0 are the absorbances at saturation and in the absence of ligand, respectively Data were normalized according to the equation (Ai ) A0 ) ⁄ (Asat ) A0 ) and reported as fractional...
  • 15
  • 337
  • 0

Xem thêm