for the income tax expense arising from these transactions with a credit to accounts in subgroup 83
Báo cáo khoa học: "Hunting for the Black Swan: Risk Mining from Text" doc
... used as alerts Data We apply the mined risk extraction patterns to a corpus of financial documents The data originates from the StreetEvents database and was kindly provided to us by Starmine, a ... constructing a possible pattern containing this new risk 4.3 Risk alerting method We compile the risk taxonomy into a trie automaton, and create a second trie for company names from the meta-data of ... in another task, risk alerting Both tasks provide computational assistance to risk-related decision making in the financial sector We described a specialpurpose algorithm for inducing a risk taxonomy...
- 6
- 416
- 0
Báo cáo khoa học: "AN EXPERT SYSTEM FOR THE PRODUCTION OF PHONEME STRINGS FROM UNMARKED ENGLISH TEXT USING MACHINE-INDUCED RULES" pdf
... features which are sufficient to classify these examples, as well as some method for extracting these features, are also available For example, consider the training set [dog, cat, eagle, whale, trout] ... classifying not only the examples contained in the training set but any other example whose feature values are known or extractable I0 The training set now consists of all of the entries from the ... SCL and the SEL, as well as all of the features for each entry At this point an initial "window" on the training set is chosen Since the inference algorithm's execution time increases comblnatorlally...
- 8
- 493
- 0
SYNTHESIZE AND INVESTIGATE THE CATALYTIC ACTIVITY OF THREE-WAY CATALYSTS BASED ON MIXED METAL OXIDES FOR THE TREATMENT OF EXHAUST GASES FROM INTERNAL COMBUSTION ENGINE
... emerging from the gas phase may react with the free valence of such a radical and dissociate (2) An adsorbed saturated molecule with a single bond may dissociate into radicals, one saturated with ... solutions to some extent These maintain a rather strong synergistic effect between Mn and Ce species on the nanometer scale for the aged alumina-modified catalyst, and increase the amount of available ... startup, the heat of combustion is transferred from the engine and the exhaust piping begins to heat up Finally, a temperature is reached within the catalyst that initiates the catalytic reactions...
- 117
- 376
- 0
Báo cáo y học: "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" pptx
... must fall within appropriate positions on the hairpin; these products must be next to each other on the same hairpin arm and shifted within a certain distance on the opposite arm; and the total ... with the reduced dataset In addition, miRTRAP also predicted 44 false positive loci These rates are comparable to the results obtained with the original dataset containing eight-fold more information ... Characterization of endogenous human Argonautes and their miRNA partners in RNA silencing Proc Natl Acad Sci USA 2008, 105:7964-7969 33 Katayama S, Tomaru Y, Kasukawa T, Waki K, Nakanishi M, Nakamura...
- 12
- 552
- 0
báo cáo khoa học: "Numerical techniques for the analysis of polygenes sampled from natural populations" ppsx
... from the original matrix Strains and cluster together and are more similar to strains and 10 than the other strains Strains and 10 share the fact that they are segregating one l A allele and three ... three A alleles For the remaining three strains, and 23 join and then are combined with strain 12 Each of these has a low frequency of the A allele Thus, the UPGMA cluster analysis appears sensitive ... reaches Similar groups and 10 are were again the obtained most 1.15 Principal coordinates analysis in another way of looking at the relationship among strains The results are summarized in the...
- 20
- 337
- 0
Báo cáo y học: " Advantages of the single delay model for the assessment of insulin sensitivity from the intravenous glucose tolerance test" doc
... of the day before the study At 7:00 a. m on the following morning, indirect calorimetric monitoring was started; the infusion catheter was inserted into an antecubital vein; the sampling catheter ... statistical analysis, drafting of the manuscript; ADG: mathematical modeling, drafting of the manuscript; GM: drafting of the manuscript; data provision; All authors read and approved the final ... equations are fitted onto the data, while in figure the insulin data are merely linearly interpolated Finally, while the close adaptation to the data is certainly an important requisite of a good...
- 20
- 284
- 0
Báo cáo y học: "Classification methods for the development of genomic signatures from high-dimensional data" potx
... basis rather than on an empirical trial-and-error basis The goal is to change medical practice from a population-based approach to an individualized approach We have presented statistical classification ... accuracy shows the real potential for confident clinical assignment of therapies on an individual patient basis Then the prediction accuracy of the ensemble can be obtained using the standard binomial ... implemented with a package (pamr) in R with a soft thresholding option as a default For single optimal trees, CART is implemented with a package (rpart) in R with a default option On the other hand,...
- 7
- 454
- 0
PERIPHERAL BLOOD a SIMPLE CELL SOURCE FOR THE GENERATION OF ANGIOGENIC PROGENITORS FROM MONOCYTES
... pro-inflammatory cytokines, are microbicidal and tumouricidal and therefore support the resistance against infections M2 are alternatively activated macrophages and the definition of M2 was expanded ... dimerise into AA, AB or BB PDGFR- β can only bind the PDGF chain B, whereas PDGFR-α can bind both PDGF chains A and B The binding of the PDGF chain to a receptor leads to the dimerisation of ... response In an attempt to analyse the involvement of macrophages in the development of the vasculature, macrophages were observed during the vascularisation of the hindbrain in the murine embryo (Fantin...
- 124
- 509
- 0
báo cáo hóa học:" Botulinum toxin type A injections for the management of muscle tightness following total hip arthroplasty: a case series" pptx
... prepared the manuscript AB, MGZ, MSM, RED, MAM ensured the accuracy of the data and analysis All authors have read and approved the final manuscript Additional material Additional file Summary ... using a bubble goniometer to assess the clinical outcome Patients were also evaluated using the Harris hip score rating system [22] Statistical Analysis Data was subjected to averaging and analysis ... met the established selection criteria Nine patients had a primary total hip arthroplasty and one patient had contractures following a revision from a bipolar to a total hip arthroplasty The patients...
- 7
- 468
- 0
Báo cáo hóa học: "Biocompatible micro-sized cell culture chamber for the detection of nanoparticle-induced IL8 promoter activity on a small cell population" pot
... This assay is based on the cleavage of stable tetrazolium salt WST-1 by metabolically active cells to an orange formazan dye The WST-1 assay was performed according to the manufacturer’s instructions, ... exposed to the nanoparticles by aspirating the medium, washing the cells with PBS, and adding the nanoparticle-containing medium After the exposure time, the cells were analyzed microscopically plasmid ... chambers in each cultivation segment guarantee a statistical analysis of the generated data The MCC represents an array of miniaturized cell culture chambers for permanent noninvasive characterization...
- 14
- 632
- 0
Báo cáo khoa học: " Protection of chickens from Newcastle disease with a recombinant baculovirus subunit vaccine expressing the fusion and hemagglutinin- neuraminidase proteins" pdf
... 5' TCCAGGTGCAAGATGGGCTCC 3' 5' AGGGAAACCTTCGTTCCTCAT 3' 5' TCAATCATGGACCGCGCCGTT 3' 5' CGCAGAAGATAGGTGATACAA 3' 5' ACATTCAGGACACAATATGGG 3' 5' CACAGGCTGCTGTTGGGTAT 3' 5' ACAAGAGTCAATCATGGACCG ... expressing the Newcastle disease virus fusion protein Avian Dis 1992, 36, 858-870 19 Mori H, Tawara H, Nakazawa H, Sumida M, Matsubara F, Aoyama S, Iritani Y, Hayashi Y, Kamogawa K Expression of the ... disease with a recombinant baculovirus hemagglutinin-neuraminidase subunit vaccine Avian Dis 1991, 35, 585-590 22 Niikura M, Matsuura Y, Hattori M, Onuma M, Mikami T Characterization of haemagglutinin-neuraminidase...
- 8
- 315
- 0
Báo cáo y học: " ncremental cost effectiveness of proton pump inhibitors for the prevention of non-steroidal anti-inflammatory drug ulcers: a pharmacoeconomic analysis linked to a case-control study" potx
... Arthritis Research & Therapy Vol 10 No Vonkeman et al with NSAIDs) with the appropriate pharmacoeconomic information Materials and methods The pharmacoeconomic evaluation was linked to a 26-month ... treatments by medical specialists or drug therapy The costs for NSAID therapy and costs related to that therapy were not taken into account as these costs are expected to be similar in both treatment ... risk for NSAID-related gastrointestinal complications, while in patients with one or more risk factors adding a PPI to a nonselective NSAID was the dominant strategy In contrast, another study...
- 7
- 381
- 0
Báo cáo y học: "Incremental cost effectiveness of proton pump inhibitors for the prevention of non-steroidal anti-inflammatory drug ulcers: a pharmacoeconomic analysis linked to a case-control study" pptx
... Arthritis Research & Therapy Vol 10 No Vonkeman et al with NSAIDs) with the appropriate pharmacoeconomic information Materials and methods The pharmacoeconomic evaluation was linked to a 26-month ... treatments by medical specialists or drug therapy The costs for NSAID therapy and costs related to that therapy were not taken into account as these costs are expected to be similar in both treatment ... risk for NSAID-related gastrointestinal complications, while in patients with one or more risk factors adding a PPI to a nonselective NSAID was the dominant strategy In contrast, another study...
- 7
- 314
- 1
Báo cáo y học: "P38 MAP kinase inhibitors as potential therapeutics for the treatment of joint degeneration and pain associated with osteoarthritis" ppsx
... hyperalgesia in rats when administered intrathecally [10] These data suggest that cytokine inhibition may be useful for treating the pain associated with OA Monoclonal anti-TNF therapies such as infliximab ... in animal models Therefore, the inhibition of proinflammatory cytokines may provide an important therapeutic approach for the treatment of OA Clinical trial data on cytokine inhibitors for the ... p38 MAP kinase pathway as a therapeutic target in inflammatory disease Curr Opin Pharmacol 2004, 4:372-377 Ashwell JD: The many paths to p38 mitogen-activated protein kinase activation in the immune...
- 8
- 461
- 0
Báo cáo khoa học: "Gas-permeable ethylene bags for the small scale cultivation of highly pathogenic avian influenza H5N1 and other viruses in embryonated chicken eggs" docx
... with laboratory tape, and the egg incubated at 34°C for most influenza A or B strains, and at 37°C for H5N1 strains During inoculation, efforts are made to avoid damage of the CAM, which can result ... containing the bacteria for 24 hrs (starting out with log-phase bacteria) In contrast, the phage infected E coli when pin-holes were made in the bags prior to immersion in flasks containing log-phase ... i.e as an added safety feature For larger-scale needs, other primary containment devices could achieve the same goal of increased containment such as tradition egg incubators placed inside a primary...
- 7
- 383
- 0
Báo cáo y học: "Pulsed moxifloxacin for the prevention of exacerbations of chronic obstructive pulmonary disease: a randomized controlled trial" pps
... activity against the major pathogens in COPD, excellent penetration into respiratory tissues, high oral bioavailability, and proven efficacy in the treatment of exacerbations, including increasing the ... resistant organisms Regular monitoring of sputum flora and, in a subgroup, of faecal flora was therefore an essential part of the PULSE study There was a transient increase in MIC of one strain ... in exacerbations in these patients is similar to that seen with long-acting bronchodilators and inhaled steroids in recent clinical trials in COPD [21-26] In a study with bronchoscopic sampling,...
- 13
- 353
- 0
Báo cáo y học: "The Council on Chiropractic Education''''s New Wellness Standard: A call to action for the chiropractic profession" ppt
... available from the 5 -A- Day website and also from 5 -A- Day coordinators in each state usually free of charge Any wellness or health promoting health care practice should become familiar with, and ... clinics, Hawk and Evans [15] found that there was no standardized method in place to gather information regarding the smoking status of patients There is undoubtedly a similar lack of standardization ... [5,8] These factors should be important to chiropractors as they primarily see back pain and neck pain patients [9] The average case mix of DCs tends to include a significant amount of chronic spine...
- 6
- 279
- 0
Báo cáo y học: "In silico evidence for the species-specific conservation of mosquito retroposons: implications as a molecular biomarker" ppt
... quinquefasciatus quinquefasciatus quinquefasciatus quinquefasciatus quinquefasciatus quinquefasciatus quinquefasciatus quinquefasciatus quinquefasciatus quinquefasciatus quinquefasciatus Identity ... to drafting the final manuscript BW, WM and KH participated in data analysis and writing the final manuscript All authors read and approved the final manuscript Funding: This work was made possible ... by trials to have promise for eradicating malaria, it may be justifiable to invest funds in them For instance, economists estimate that malaria accounts for approximately 40% of public health...
- 8
- 259
- 0
Báo cáo sinh học: "Probability statements about the transmitting ability of progeny-tested sires for an all-or-none trait with an application to twinning in cattle" pptx
... in asymptotic theory (see for instance, formula 6a. 23, page 386 in Rao, 1973) and knowing that: is also one has, given Assuming to a i a as in section II B that, a priori, the f-Li’S i -L f with ... m r taken as fixed in uu units, variations in the progeny number n are rather less b pronounced These variations (An) in n are proportional to variations (A ) in ETA within the range of values ... TA taken as a minimum and 7i’, the ETA value according to formulae (5b) and (6) Minimum TA and ETA values were expressed in percent as well as, for r practical purposes, deviations from in Q...
- 18
- 313
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng 9 tr 25