... authors established the asymptotics ofthe zeros of such Jacobi-Sobolev polynomials The aim of our contribution is to obtain a lower bound forthe norm ofthe partial sums ofthe Fourier expansion ... We call them the Jacobi-Sobolev orthogonal polynomials The measures μα,β and μα 1,β constitute a particular case ofthe so-called coherent pairs of measures studied in In see also , the authors ... in the norm of S∞ Acknowledgments The authors thank the careful revision ofthe paper by the referees Their remarks and suggestions have contributed to improve the presentation The work of the...
... work together to make software that is readable, scalable, maintainable, and elegant In addition to these individual authors and thought leaders, we also want to acknowledge the thousands of students ... don’t want to test them We want to be able to refactor them (even eliminate them) and have the same tests pass as before we refactored • We need to test them individually, as a practical matter ... processLargeTransaction(), and processSmallTransaction()) are not part ofthe API ofthe object but are simply the functional steps along the way They are often called “helper methods” as a result For...
... GTTAGTAGGTGAGAAATCGGCGGTTCAGTTTAACAGCAACA TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTGGCCTGAACCCACGATTTCTC TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA ... GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA TCTGCCCCTGGAGCCCTGCCCCA TGGGGCAGGGCTCCAGGGGCAGA CCTCGTCCTGCCGCCTCCAATGCTCTGGA TCCAGAGCATTGGAGGCGGCAGGACGAGG GCTCTGGAGCCTGACGCCAAGGCTCTGAGTATTGC GCAATACTCAGAGCCTTGGCGTCAGGCTCCAGAGC ... b-DG(654–750), and Asat and A0 are the absorbances at saturation and in the absence of ligand, respectively Data were normalized according tothe equation (Ai ) A0 ) ⁄ (Asat ) A0 ) and reported as fractional...
... ofthe investors and the cash resources ofthe AIF or, where applicable, the AIFM working forthe AIF, are being transferred properly tothe relevant accounts opened in the name ofthe AIF, the ... in Kazakhstan are provided by the Almaty branch of Dechert Kazakhstan Limited A list ofthe names ofthe directors of Dechert Kazakhstan Limited is available for inspection at its registered office: ... expansion ofthe GITA tothe future area of application ofthe draft ofthe GIC appears unlikely because (for InvestmentKGs) this would interfere withthe general income tax principles for taxation of...
... myristoylation motifs Met-Gly-Xaa-Ala-Ala-Ala-Ala-Ala-Ala-Ala (Myr–AGG1-3X 6A) or Met-Gly-Xaa-Ala-Ala-Ser-AlaAla-Ala-Ala (Myr–AGG1-3X6S), with position of each motif separately occupied by each of ... N-myristoylation (A) Structure of mature AGG1 fused at its N-terminus tothe myristoylation motifs Met-Gly-Xaa-Ala-Ala-Ala-Lys-Ala-AlaAla (Myr–AGG1-3X 6A7 K) or Met-Gly-Xaa-AlaAla-Ser-Lys-Ala-Ala-Ala ... (Toyobo), yielding pTA2–AGG1 The coding region for mature AGG1 fused witha DNA fragment encoding the myristoylation motif Met-Gly-Ala-Ala-Ala-Ala-Ala-AlaAla-Ala or Met-Gly-Ala-Ala-Ala-Ser-Ala-Ala-Ala-Ala...
... responses against the melanoma Thus the further development of this agent to be used as an immunogenic antigen in vaccine related therapies against melanoma is warranted Abbreviations ALT: alanine aminotransferase; ... Kimura A, Kato H, Sasazuki T: DNA typing ofthe HLA -A gene: population study and identification offor new alleles in Japan Tissue Antigens 1996, 47:93-101 24 Imanishi T, Akaza T, Kimura A, Tokunaga ... before each vaccination and weeks after the last vaccination forthe immunological monitoring Drawn blood was heparinized, prepared for PBMCs with Ficoll-Paque (Amersham Biosciences, Piscataway,...
... angle ofthe scapula (origin ofthe musculus levator scapulae) and on the lateral upper margin ofthe scapula forthe m trapezius The tests for compression and traction ofthe neck are used to ... the other A soft end point or lack ofa stop at the end ofthe range of movement ("drawer") is evidence ofa lesion ofthe cruciate ligament [22] For reasons of practicability, occupational medicine ... system takes into accountthe fact that occupational medical prophylaxis does not aim primarily at producing a therapeutic indication but at prevention From the large number of available validated...
... myotonias and inflammatory myopathies Quantitative data The percentage of UK and US patients scoring some impact (i.e scoring tofor extent of impact), or no impact (scoring 1) for each ofthe ... MD These included a) planning; “Because ofthe condition it is not easy to things on the spur ofthe moment It is not always practical to go to places that are new to me without a bit of forward ... is made up ofa variety of individual diseases each of which may each be rare It is reasonable to study them collectively as all MD may have common symptoms of weakness, fatigue, or pain and...
... cases of fusion with extra data situations lead to relatively better performance Therefore, the main emphasis is given to this monoradar case, leaving the definition of performance for other cases ... the accuracy and quality of available data, while target conditions are the distance and orientation ofthe flight with respect to radar, motion state of aircraft (uniform velocity, turning, accelerating), ... process to adjust the filter parameters according to ARTAS specifications are presented and analyzed They have been obtained particularizing expression (6) tothe case ofa weight offor all magnitudes...
... 2, with endpoints b, c and central angle π Similarly arcs Ab and Ac are defined In other words, the points a, b, c and the arcs Aa , Ab , Ac form the vertices and edges ofa Reuleaux triangle of ... that Da and Db have a non-empty intersection Let ua and va be the intersections ofthe boundary of Da withthe semicircle Sb , such that ua is higher than va Similarly we define ub and vb as the ... than va and ub higher than a , the regions Da and Db would be disjoint (they would be separated by the line va a , for example) Since there is a point ca ∈ Db on the upper boundary of Da , either...
... 1992) as The cummulative degree-day values were always calculated from January of each year Statistical analysis Calendar days and the different heat sums, obtained withthe aforementioned formula, ... distribution of intra-group variances Infection percentages were analysed using a generalization ofthe analysis of variance adapted to categorical data analysis (CATMOD procedure of SAS) A log-linear ... coefficients of variation (CV), ie the ratio ofthe mean tothe standard deviation of these values, were then calculated The approach using the standard error of prediction is based on the comparison...
... transplantation for hepatocellular carcinoma in cirrhotic patients: a critical factor American Journal of Transplantation 2010, 10:129-137 20 Sakata J, Shirai Y, Wakai T, Kaneko K, Nagahashi M, Hatakeyama ... Ichida T, Makuuchi M, Matsuyama Y, Nakanuma Y, Okita K, Omata M, Takayasu K, Yamaoka Y: Reevaluation of prognostic factors for survival after liver resection in patients with hepatocellular carcinoma ... Wakai T, Shirai Y, Yokoyama N, Nagakura S, Hatakeyama K: Hepatitis viral status affects the pattern of intrahepatic recurrence after resection for hepatocellular carcinoma European Journal of...
... http://www.jbiomedsci.com/content/17/1/34 Page of 13 Figure Comparison of AAG with abrin -a (green) molecule The α-carbon backbone of abrin -a AB-chains are superimposed on that ofthe AAG molecule using least-squares analysis A P41212 ... comparison of abrin -a (red) and γ3 respectively Active site residues are drawn in red (b) Active Site comparison of abrin -a (red) AAG A- chain (black) AAG A- chain (black) and AAG C-chain (blue) These ... programs They also thank tothe National Science Council of Taiwan for financial support They are indebted to SPring-8 and the National Synchrotron Radiation Research Center for data collection Author...
... ofthe residuals was examined to test for local independence The variance explained by the Rasch measures forthe empirical calculation should be comparable to that ofthe model (>50% for an acceptable ... scale Although the raw variance explained by the PCA ofthe residuals was adequate (64.2%), the unexplained variance in the first contrast ofthe residuals was 3.9, suggesting the existence ofa ... data available, respondents and non-respondents seemed no different However, too limited data was available for non-responders to allow fora statistical comparison Ethical approval was obtained...
... used to improve load-bearing capacity for implants, whereas the use of vertical alveolar grafting for augmentation without implant Orthoalveolar form is the concept for optimal restauration ofthe ... endosseous Camlog® implants were accurately positioned in the mandible and the maxilla according tothe predefined planning that was made up of DVT scan and a wax up Again bone augmentation around the ... criteria for restauration ofthe edentulous maxilla and mandible are adequate bone mass and ortholalveolar form [6] This can be achieved by augmentation ofthe available substrate using established techniques...
... 20 years Head of School Dr Margaret (Sissy) Wade charged Compton and other FRA IT staff withthe task of technology planning and project management forthe new cabling system Compton’s team designed ... renovation ofthe upper school building that houses humanities and social studies, and the south campus that houses foreign language classrooms At the same time, planning began fora new state -of -the- art ... the overall size of FRA to more than 330,000 square feet of learning space “Our ultimate goal is to be able to broadcast using video over IP from any space on campus For example, if we want the...
... Colostomy: A Guide (also available in Spanish) Ileostomy: A Guide Urostomy: A Guide Laryngeal and Hypopharyngeal Cancer (also available in Spanish) Nasal Cavity and Paranasal Sinuses Cancer Oral ... you may need a “loan” from one ofthe others to balance your account Try to be aware ofthe costs of cancer in your life Make a special effort to get new deposits forthe accounts that remain active ... Cavity and Oropharyngeal Cancer Salivary Gland Cancer (also available in Spanish) Sarcoma – Adult Soft Tissue Cancer (also available in Spanish) Books The following books are available from the...
... regulatory framework This ambiguity means that the easiest approach for auditors is to take the word “separate” to mean “separate hardware,” and simply insist on separate servers or a separate ... audits are actually assessing the same controls in the same way More important, collecting audit information manually forces auditors to create and format their audit from scratch, often manually ... Channel data is almost always transported in clear text Because of this, Fibre Channel architectures are susceptible to attacks of several types that are analogous to attacks in the physical Ethernet...
... Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam Abigail Adams During the Revolution, by John Adams and Abigail Adams and Charles Francis Adams ... Adams and Abigail Adams and Charles Francis Adam 40 I have enjoyed as good health as usual, and much more than I know how toaccount for, when I consider the extreme heat ofthe weather and the ... absolutely necessary tothe maintenance ofthe fabric of society Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam Perhaps the preceding detail belongs...