for cytochrome cd1 nitrite reductase nire
Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt
... Structureof cytochrome c nitrite reductase. Nature 400, 476–480.15. Einsle, O., Stach, P., Messerschmidt, O.A., Simon, J., Kro¨ger, A.,Huber, R. & Kroneck, P.M.H. (2000) Cytochrome c nitrite reductase ... dithiothreitol, boiling for 1 min. The gel was stained for heme c.(C)Gelof16· 18 cm. Protein treatment: no dithiothreitol, noboiling. The gel was stained for nitrite reductase activity.3906 ... properties of cytochrome c nitrite reductase fromDesulfovibrio desulfuricans ATCC 27774. J. Biol. Chem. 271,23191–23196.25. Liu, M.C., Costa, C. & Moura, I. (1994) Hexaheme nitrite reductase...
- 12
- 593
- 0
Báo cáo khoa học: Copper-containing nitrite reductase fromPseudomonas chlororaphis DSM 50135 Evidence for modulation of the rate of intramolecular electron transfer through nitrite binding to the type 2 copper center pot
... Methylomonas sp.; cd1-Nir, cytochrome cd1 nitrite reductase; Cu-Nir, copper-containing nitrite reductase isolated from Pseudomonas chlororaphis DSM 50135;cyt., cytochrome; DDC, diethyldithiocarbamate; ... of the as-purified (blue) form ofthe Ps. chlororaphis DSM 50135 nitrite reductase. [Cu-Nir] ¼ 23 lMin20 mMTris/HCl buffer pH 7.6.Ó FEBS 2004 Cu-containing nitrite reductase from Ps. chlororaphis ... protein. The pI of other copper nitrite reductasesdescribed in the literature are also acidic, except for theAl. xylosoxidans NCIB 11015 protein [1]. The pI deter-mined for Ps. aureofaciens Cu-Nir...
- 9
- 393
- 0
Tài liệu Báo cáo Y học: Mutations in the docking site for cytochrome c on the Paracoccus heme aa3 oxidase Electron entry and kinetic phases of the reaction pptx
... of the acidic regionresponsible for cytochrome c docking. While no directstructural information is at hand for the docked complex,the interaction domain for cytochrome c on the cyto-chrome ... the reaction. For analternative explanation to account for this phenomenon, wefind no evidence for a second cytochrome c binding site onoxidase.Keywords: Paracoccus denitrificans; cytochrome c ... R. & Bosshard, H.R. (1980) Comparison of the bindingsites on cytochrome c for cytochrome c oxidase, cytochrome bc1and cytochrome c1. J. Biol. Chem. 255, 4732–4739.8. Taha, T.S.M. &...
- 9
- 457
- 1
Tài liệu Báo cáo khoa học: The Pseudomonas aeruginosa nirE gene encodes the S-adenosyl-L-methionine-dependent uroporphyrinogen III methyltransferase required for heme d1 biosynthesis doc
... vitro.Initially we performed enzyme assays with all three NirE proteins – NirE- His, Trx-S -NirE- His and S -NirE- His – and compared their catalytic activities. Weobserved that Trx-S -NirE- His and S -NirE- His ... vectors For the construction of nirE expression vectors, the nirE gene from P. aeruginosa PAO1 was PCR amplified usingthe primers nirE_ Pa_BamHI _for (GCCGGGATCCATGAACACTACCGTGATTC) and nirE_ Pa_XhoI_rev(GACTCGAGGGCGCATGCGAC) ... respectively, for cloning the nirE gene into pET32a (Novagen, Darmstadt,Germany). For cloning the nirE gene into pET22b (Nov-agen), the PCR primers NirE_ NdeI (GTCATATGACACTACCGTGATTCC) and NirE_ HindIII...
- 10
- 539
- 0
Tài liệu Báo cáo khoa học: Pathways and products for the metabolism of vitamin D3 by cytochrome P450scc docx
... resulted in the formation of 20,23-di-hydroxyvitamin D3 (RT = 30 min) and trihydroxyvi-tamin D3 (RT = 22 min) (Fig. 4A). A small lag (0–3 min) was seen in the time course for formation oftrihydroxyvitamin ... by cytochrome P450scc R. C. Tuckey et al.2596 FEBS Journal 275 (2008) 2585–2596 ª 2008 The Authors Journal compilation ª 2008 FEBSPathways and products for the metabolism of vitamin D3by cytochrome ... correlations for 3-CH and 23-CH; (B) expan-sion of proton–proton TOCSY correlations for 3-CH and 23-CH; (C)expansion of proton–carbon HSQC showing groups having correla-tion to 3-CH and 23-CH (for...
- 12
- 704
- 0
Báo cáo khoa học: Inter-flavin electron transfer in cytochrome P450 reductase – effects of solvent and pH identify hidden complexity in mechanism potx
... for the model reaction of NADPH cytochrome P450oxidoreductase with cytochrome c. Biochemistry 33,12012–12021.S. Brenner et al. Electron transfer in cytochrome P450 reductase FEBS Journal 275 (2008) ... NADPH cytochrome P450 oxidore-ductase with cytochrome P450 and cytochrome c. J BiolChem 270, 27475–27480.27 Shen AL & Kasper CB (1996) Role of Ser457 ofNADPH cytochrome P450 oxidoreductase ... model NADPH cytochrome P450 oxidore-ductase reaction with cytochrome c. Biochemistry 34,12768–12774.25 Shen AL, Christensen MJ & Kasper CB (1991)NADPH cytochrome P-450 oxidoreductase....
- 18
- 414
- 0
Báo cáo khoa học: Evidence for two different electron transfer pathways in the same enzyme, nitrate reductase A from Escherichia coli potx
... model for nitrate reductase A from Escherichia coli.Keywords: cytochrome b; electron transfer; Escherichia coli;nitrate reductase A; quinone.Nitrate can be used as an electron acceptor for anaerobicgrowth ... order to clarify the role of cytochrome in nitrate reductase we have performed spectrophotometric and stopped-flowkinetic studies of reduction and oxidation of the cytochrome hemes with analogues ... interaction between the cytochrome and the quinones by studying inhibition of thenitrate reductase activity by HOQNO. It has thereforeclarified the binding site of the menaquinols, but for technicalreasons...
- 8
- 442
- 0
Báo cáo khoa học: D88A mutant of cytochrome P450nor provides kinetic evidence for direct complex formation with electron donor NADH ppt
... few water molecules isformed upo n Fe3+–NO c omplex formation, and that thenetwork should play a key role in providing a proton that i srequired for intermediate formation [9,10]. As shownpreviously, ... concentrations for kinetic analysis when thesemutant proteins are utilized, which is impossible with thewild-type P450nor, a s noted above. As shown in Fig. 5, thekobs for the reduction step for the ... trace of I formationcan avoid the interf erence due to the s pontan eous dec omposition of Ithat follows its formation, although the rate of decomposition is m uchslower than that of I formation...
- 8
- 405
- 0
Báo cáo khoa học: Kinetic and binding studies with purified recombinant proteins ferredoxin reductase, ferredoxin and cytochrome P450 comprising the morpholine mono-oxygenase from Mycobacteriumsp. strain HE5 ppt
... was performed with whole-cell DNA as the templateaccording to the following parameters: 94 °C for 4 min;10 cycles of 94 °C for 15 s, 52 °C for 30 s, 72 °C for 30 s; 20cycles of 94 °C for 15 ... Fe3S4ferredoxin.An absolute requirement for ferredoxin in cyto-chrome c reduction has been shown for several P450reductases [32–34]. FdRmorwas capable of reducing cytochrome c on its own, although ... results were obtained for flavodoxin reductase from E. coli [35] and ferredoxin reductase from Streptomyces griseus [36]. In contrastto the latter and to putidaredoxin reductase [32], thetwo-electron...
- 12
- 372
- 0
Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc
... scheme proposed for the S. aureus CoADR.It is interesting to note, however, that the overallshape of the titration curve at 452 nm for the sta-phylococcal enzyme and 460 nm for the phCoADR ... itmakes sense for the enzyme to stabilize the EH4form,since the reduced flavin is reactive with O2.Other enzymes in the family, such as the NADHperoxidase or glutathione reductase, tend ... disul-fide reductase family can be divided into two classes:(a) enzymes whose function appears to be the main-tenance of a high R-SH ⁄ R-S-S-R ratio, such asglutathione reductase, trypanathione reductase...
- 12
- 420
- 0
Báo cáo khoa học: Sequences downstream of the transcription initiation site are important for proper initiation and regulation of mouse ribonucleotide reductase R2 gene transcription ppt
... RNA products were used for primer extension experi-ments.Thesameprimer,specificfortheluciferaseopen-readingframewas used for all constructs. Arrows indicate the position for the twomajor transcription ... reporter gene in stably transformedcells, even at high concentrations of polyamide. Werealized that we had taken for granted that the R2TATA-box is essential for transcription initiation at ... extracts for 15 min on ice in the binding bufferbefore adding the labeled probe.Transfection of cells, serum starvation and luciferaseassaysTransient transfection, isolation of stably transformed...
- 11
- 417
- 0
Báo cáo Y học: Substrates modulate the rate-determining step for CO binding in cytochrome P450cam (CYP101) A high-pressure stopped-flow study pdf
... P450is therefore indicative rather for a high solvent accessibilityof the heme pocket than for a diffusion limited process.Subconformers of P450cam have differentkonand DV# for CO bindingThe ... studied, we note that for the class Isubstrates CO binding is disfavoured because of a rigidheme pocket and the search for the optimal place near theheme for CO-iron bond formation appears to ... dithionite, values for concentrations correspond to the mixture.bThe mean values for konand DV#are given with their ± SD.Fig. 3. Plot of lnkonagainst the pressure for cytochrome P450cambound...
- 8
- 453
- 0
Báo cáo khoa học: Kinetic deuterium isotope effects for 7-alkoxycoumarin O-dealkylation reactions catalyzed by human cytochromes P450 and in liver microsomes Rate-limiting C-H bond breaking in cytochrome P450 1A2 substrate oxidation pdf
... deuter-ium isotope effects for both 7-OMe and 7-OEt coumarin dealkylation reac-tions. The apparent intrinsic isotope effect for P450 1A2 (9.4 for O-demethylation, 6.1 for O-deethylation) showed ... (1984)Kinetic isotope effects on cytochrome P-450-catalyzedoxidation reactions: evidence for the irreversible forma-tion of an activated oxygen intermediate of cytochrome P-448. J Biol Chem 259, ... (9.6 for O-demethylation, 6.1 for O-deethylation) was attenu-ated in the noncompetitive intermolecular experiments. High noncompeti-tive intermolecular kinetic isotope effects were seen for...
- 9
- 314
- 0
Báo cáo khoa học: The first cytochrome P450 in ferns Evidence for its involvement in phytoecdysteroid biosynthesis in Polypodium vulgare doc
... anextinction coefficient of 91 mm)1Æcm)1(A450)490) for P450and 111 mm)1Æcm)1(A420)490) for the cytochrome P420 [23,24]. When both P450 forms were present, the totalP450 content was estimated ... as a cytochrome P450. Science 25, 781–784.36 Kochs G, Werck-Reichhart D & Grisebach H (1992)Further characterization of cytochrome P450 involvedin phytoalexin synthesis in soybean: cytochrome ... the purification of plantcytochromes P-450 and b5. Anal Biochem 197, 125–131.40 Andersen MD & Moller BL (1998) Double TritonX-114 phase purification for the plant cytochromesP450 and removal...
- 9
- 247
- 0
- english for tourism and hospitality
- elementary english for tourism
- elementary english for hospitality
- tactics for toeic
- english for tourism and hospitality
- vocabulary for english
- english for business
- english for kids
- cyp175a1 fromthermus thermophilusis a thermophilic cytochrome p450 and has great potential for industrial applications however
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25