folder and abstract its location with a dfs namespace
The herpetofauna of the peruvian dry forest along the andean valley of the marañón river and its tributaries, with a focus on endemic iguanians, geckos and tegus
Ngày tải lên :
19/11/2015, 15:51
... flanks of the Chinchipe, Chamaya, Huancabamba and Utcubamba rivers and tributaries (Regions Piura, Cajamarca, Amazonas) southwards along the deep and narrow valleys of the Marañón River and its ... tamandua (Tamandua mexicana), the Sechuran fox (Pseudalopex sechurae), the puma (Puma concolor), the jaguar (Panthera onca), the ocelot (Leopardus pardalis) the tayra (Eira barbara), the collared ... the Region Amazonas, in Chacanto, Region Cajamarca and in various localities in the Region La Libertad (San Vicente/Pusac, Santa Rosa/El Tingo, Vijus, Chagual, Calemar, and Pias) at elevations between...
- 264
- 492
- 0
Reproductive System Structure, Development and Function in Cephalopods with a New General Scale for Maturity Stages pot
Ngày tải lên :
14/03/2014, 16:20
... dull-white At the end of this stage the first spermatozoa appear in testis SG is dull-white Gonad is large, opaque and appear granular Oocytes are at intercalary and protoplasmic growth phase AG are ... column (Shimamura and Fukataki, 1957; Young and Harman, 1985) Their eggs accumulate in the oviducts and are covered with secretions of oviductal glands only, nidamental glands being absent Egg ... include appearance, differentiation and growth of gonad and accessory glands At this time oogenesis and spermatogenesis take place in the gonads As already mentioned, gametogenesis differs significantly...
- 12
- 623
- 0
Art and design courses 2013 with a deadline of 24 March pot
Ngày tải lên :
31/03/2014, 15:20
... University Main Site Main Site W616 BA 2D Digital Animation W21F BA Design: Animation, Visual Effects and Game Art Duration: 3FT Hon Duration: 3FT Hon W617 BA 3D Digital Animation W201 BA Design: Applied ... W640 FdA Photography (with Video) Duration: 2FT Fdg WP15 BA 3D Animation and Games Duration: 3FT Hon W615 BA Animation Duration: 3FT Hon W232 BA Fashion Textiles Duration: 3FT Hon Art and design ... W191 BA Art and Design Fine Art Duration: 3FT Hon Art and design courses 2013 (deadline 24 March) W190 BA Art and Design Fine Art (including Yr 0) W216 BA Graphic Design Duration: 4FT Hon Duration:...
- 13
- 433
- 0
a pros and cons of traveling with a tour group
Ngày tải lên :
06/09/2015, 23:55
... Some of us are great at making anything up on the spot and this shoots that practice into the ground Of course, now -a- days every other person has a smart phone with internet access and ruins the ... the Blarney Stone That Pesky Schedule Again Pro: Having to meet a tight schedule forces you to get up early every day Con: Having to meet a tight schedule forces you to get up early every day ...
- 2
- 355
- 0
Báo cáo hóa học: " Research Article A New Hilbert-Type Linear Operator with a Composite Kernel and Its Applications" pot
Ngày tải lên :
21/06/2014, 07:20
... UK, 1934 B C Yang, “On a more accurate Hardy-Hilbert-type inequality and its applications,” Acta Mathematica Sinica, vol 49, no 2, pp 363–368, 2006 Chinese B Yang, “On a more accurate Hilbert’s ... inequality,” International Mathematical Forum, vol 2, no 37–40, pp 1831–1837, 2007 W Zhong, A Hilbert-type linear operator with the norm and its applications,” Journal of Inequalities and Applications, ... 2 Journal of Inequalities and Applications where the constant factors π and π are the best possible also Expression 1.2 is called a more accurate form of 1.1 Some more accurate inequalities...
- 18
- 340
- 0
half year report 1999 good half-year results with a further increase in net income the holderbank group confirms its strength and flexibility in the face of rapidly changing market conditions
Ngày tải lên :
27/07/2014, 16:05
... South Africa has plants in Nicaragua and the Dominican set stability and continuity as its pri- Republic and the sale of the Brazilian mary goals, demand was generally concrete chemicals unit weak ... international finan- also making considerable headway on cial markets, Central America and parts various projects The doubling of ca- of the Caribbean reported positive pacity at the Midlothian plant ... Australia and New Zealand Queensland Cement and Milburn New Zealand Ready-mixed concrete reported solid sales increases of 12 percent and 24 percent respectively achieved by Milburn New Zealand,...
- 35
- 314
- 0
Báo cáo y học: "Prevalence of alexithymia and its association with anxiety and depression in a sample of Greek chronic obstructive pulmonary disease (COPD) outpatients" pptx
Ngày tải lên :
08/08/2014, 23:21
... draft the paper; GM and AK helped draft the paper; II carried out the statistical analysis and helped draft the paper; NS and AV supervised the study; NT carried out Page of the statistical analysis, ... K, Ohi M, Nakagawa M, Fujita M, Sato K, Shimada K, Yamaoka S, Oda Y, Asai N, Sagawa Y, Kuno K: Relationship between dyspnoea in daily life and psycho-physiologic state in patients with chronic ... depression and anxiety in patients with COPD: relationship to functional capacity Chest 1985, 87:35-38 15 Maurer J, Rebbapragada V, Borson S, Goldstein R, Kunik M, Yohannes AM, Hanania NA: Anxiety and...
- 7
- 436
- 0
Báo cáo y học: " Distribution of hepatitis C virus genotypes in patients infected by different sources and its correlation with clinical and virological parameters: a preliminary study" pptx
Ngày tải lên :
13/08/2014, 13:20
... of patients 1a (N = 59) Age (years )a Male/Female (%male) Transmission of HCV Post-transfusional IVDA Sexual Hemodialysis Hemophilia Thalassemia Inmate Travel abroad Hejamate Other risk factors ... drafted the manuscript AK and S-MA conceived and coordinated the study, helped to draft the manuscript, and made the statistical analysis All authors read and approved the final manuscript References ... 1a and 1b and two cases with genotype 3a had co-infection with hepatitis B virus (P < 0.001) Only one patient with mixed infection with genotype 1a and 1b and one case with genotype 1b had jaundice...
- 6
- 337
- 0
Báo cáo y học: " The diagnostic value of serum leptin monitoring and its correlation with tumor necrosis factor-a in critically ill patients: a prospective observational study" ppt
Ngày tải lên :
13/08/2014, 20:21
... using either ANOVA or Student’s t-test while non-parametric data were analyzed using Mann-Whitney U and c 2- tests Data were presented as mean and standard deviation A P-value of < 0.05 was considered ... SIRS and those with sepsis in patients suffering from a broad range of diseases in ICU and its correlation with other biomarkers Materials and methods After the study was approved by an investigational ... phase reactant Studies by Maruna et al., [18] and Yamaguchi et al., [19] demonstrated that a significant correlation between leptin and TNF-alpha can be a crucial regulator of leptin generation It...
- 9
- 306
- 0
Báo cáo y học: "A third-generation microsatellite-based linkage map of the honey bee, Apis mellifera, and its comparison with the sequence-based physical map" pps
Ngày tải lên :
14/08/2014, 07:21
... data are available with the online version of this paper Additional data file is a PDF file containing a microsatellite-based genetic map of the honey bee, AmelMap3 Additional data file is an ... Issue 4, Article R66 Solignac et al assemblies The simultaneous availability of genetic and physical data also provided the opportunity for mutual quality control and to reach a quasi-colinearity ... B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, et al.: A high-resolution recombination map of the human refereed research We thank Martial Marbouty, Marion Segalen, Bertrand Lachaise, Christelle...
- 14
- 261
- 0
THE STUDY OF a NOVEL MIXED LINEAGE LEUKEMIA 5 ISOFORM AND ITS ASSOCIATION WITH HUMAN PAPILLOMAVIRUS 16 18 RELATED HUMAN CERVICAL CANCERS
Ngày tải lên :
02/10/2015, 17:15
... Forward CCACCACAAAAGAAAAAGGTTTCTC Reverse GTGTTGGTAAAGGTAGGCTAGC MLL5β Forward GAAAACCCAGAGTGCCCTGTTCTA Reverse CAATATACGCGAGACTAGTCTT GAPDH Forward GTGAAGGTCGGAGTCAACG Reverse TGAGGTCAATGAAGGGGTC ... CGCGGATCCAATGGACTACAAAGACGATGAC GACAAGAGCATAGTGATCCCA MLL5β M5b_NotI.rev AAGGAAAAAAGCGGCCGCCAATATACGCGA GACTAGTCTT GFPMLL5β M5b_SalI.for ACGCGTCGACATGAGCATAGTGATCCCATTG M5b_BamHI.rev CGCGGATCCCAATATACGCGAGACTAGTCTT Primers ... CATCTGACATATTTTCCCGCTTCCGGCGTTGT AGTAGCAC 36 GFP- M5_Y35 8A. for AGAGGGAAGTTTATG MLL5β‐ SET mut ATTTGCCTCCTGATGCACTTATCATTGAAGCC M5_Y35 8A. rev CATAAACTTCCCTCTGGCTTCAATGATAAGTG CATCAGGAGGCAAAT...
- 140
- 396
- 0
Computational fluid dynamics (CFD) modelling of a continuous baking oven and its integration with controller design
Ngày tải lên :
03/10/2015, 21:56
... presentation and interpretation of the data and images With the availability of a wide range of commercial CFD softwares, CFD has began to gain its popularity in many applications Users are not required ... devise a CFD model that can absolutely accurately simulate the heat and mass exchanges in a real operating plant (Mirade et al., 2002) In addition, the specific food material properties and food ... considered as solid materials with constant density, while both heat capacity and thermal conductivity were functions varying with temperature A full factorial experimental plan was generated Temperature...
- 148
- 566
- 0
Propelling Business Growth With A Secure And Continuous Information Infrastructure
Ngày tải lên :
24/04/2013, 20:04
... from tape and validated Application: restored from tape and validated Data: restored from tape and validated Connectivity: restored and validated Redundancy of data: recover lost transaction ... transaction and validate Redundant site: ready (warm site) Recovery plans: ready OS: restored from tape and validated Application: restored from tape and validated Data: restored from tape and ... restored from tape and validated Connectivity: restored and validated Redundancy of data: recover lost transaction and validate OS: ready Application: ready Data: ready Connectivity:...
- 27
- 346
- 0
River Water Quality Analysis of Hadano Basin and its Relationship with Nonpoint Sources of Pollution
Ngày tải lên :
05/09/2013, 10:17
... (Tributary) Yamanokami Minasebashi Sakurabashi Shintokiwabashi Sakurazawabashi 10 Shiyamabashi 11 Kobane 12 Kuzuhaohashi 13 Kusawabashi 14 Minoge 15 Kanamegawabashi 16 Ochiaibashi River Basin No ... population (person), agriculture area (m2), urban area (m2) and forest area (m2) In the case of agriculture area, as it contains paddy field and cultivated land, the total area was calculated as an ... Groundwater balance of Hadano Basin, Mizunasi River alluvial fan In: Water balance of Japan, Eds Ichikawa M and Hine I., pp.146-156, Kokon Shoin Ltd., Tokyo (in Japanese) Japanese Standards Association...
- 28
- 593
- 0
Tài liệu The NULL Encryption Algorithm and Its Use With IPsec ppt
Ngày tải lên :
14/02/2014, 16:20
... interoperable NULL implementations test_case = data = data_len = NULL_data = 0x123456789abcdef 0x123456789abcdef test_case = data = data_len = NULL_data = "Network Security People Have A Strange ... some authentication algorithm is as cryptographically secure as a packet secured using AH with the same authentication algorithm) As stated in [ESP], while the use of encryption algorithms and authentication ... encryption algorithms and implementations of the base algorithm are available for all commonly used hardware and OS platforms 2.5 Test Vectors The following is a set of test vectors to facilitate in...
- 7
- 425
- 0
Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx
Ngày tải lên :
18/02/2014, 13:20
... of a three-stranded antiparallel b-sheet and an a- helix, packed approximately parallel to the b-sheet, with the seven thoroughly conserved amino acids (Arg6, Arg8, Trp10, Glu16, Arg18, Arg26 and ... performed as described previously [9] Selection of the DNA-binding site A 60 bp single-stranded DNA RDM10, with 10 randomized oligonucleotides in the center, i.e CTGTCAGTGAT GCATATGAACGAATN10AATCAACGACATTAGGATC ... from amino acid sequence data Anal Biochem 182, 319–326 Liu Q, Kasuga M, Sakuma Y, Abe H, Setsuko M, Yamaguchi-Shinozaki K & Shinozaki K (1998) Two transcription factors, DREB1 and DREB2, with an...
- 10
- 464
- 1
Tài liệu Báo cáo khoa học: Differentiation stage-dependent preferred uptake of basolateral (systemic) glutamine into Caco-2 cells results in its accumulation in proteins with a role in cell–cell interaction pptx
Ngày tải lên :
20/02/2014, 01:20
... ratio obtained at h (data not shown) At 30 the basolateral ⁄ apical uptake ratio was 9.1 ± 3.7 and 5.2 ± 0.3 for 5-dayand 15-day-differentiated cells, respectively At 24 h the basolateral ⁄ apical ... dose and route of supplementation Data from a meta-analysis suggested that glutamine supplementation in critically ill patients may be associated with a decrease in complications and mortality rate, ... h of labelling, apical (C) and basolateral (D) neonatal and postweaning pigs [60] The fact that this enzyme has a quite high turnover in the Caco-2 cells may indicate that a substantial amount...
- 15
- 506
- 0
Tài liệu MECHANICAL PROPERTIES OF THE HEART AND ITS INTERACTION WITH THE VASCULAR SYSTEM ppt
Ngày tải lên :
22/02/2014, 09:20
... provide a detailed understanding of the heart as a muscular pump and of the interaction between the heart and the vasculature The concepts of contractility, preload and afterload are paramount ... with maintaining adequate blood pressure and cardiac output by manipulating ventricular contractility, heart rate, arterial resistance and ventricular preload Two approaches to understanding how ... preload, afterload, compliance To understand what Frank-Starling Curves are and how they are influenced by ventricular afterload and contractility To understand how afterload resistance can be represented...
- 23
- 578
- 0
Báo cáo khoa học: Crystal structures of the apo form of b-fructofuranosidase from Bifidobacterium longum and its complex with fructose pot
Ngày tải lên :
06/03/2014, 00:21
... b-fructofuranosidase gene was amplified using TaKaRa Ex TaqÔ polymerase (Takara Bio Inc., Shiga, Japan) and specific primers: forward primer 5¢-GCACG CTCTAGATGACTGACTTCACTCCTGAAACC-3¢ and reverse primer 5¢-GCATTCTCGAGCTCCAGTCCGATG ... Eneyskaya EV, Kulminskaya AA, Shabalin KA, Shishliannikov SM et al (2002) Purification, characterization, gene cloning and preliminary Xray data of the exo-inulinase from Aspergillus awamori Biochem J ... 60] and raffinose [a- d-Gal-(1,6) -a- dGlc-(1,2)-b-d-Fru] Natural sources of inulin-type fructans are chicory, Jerusalem artichokes, asparagus, wheat, garlic, onions, leeks, bananas, barley, tomatoes...
- 17
- 521
- 0
