0

flat a brief history of the twenty first century further updated and expanded 3rd edition

Public And Private Schools How Management And Funding  Relate To Their  Socio-Economic  Profile

Public And Private Schools How Management And Funding Relate To Their Socio-Economic Profile

Tổng hợp

... Argentina Spain Qatar Japan Panama Denmark Peru Colombia Jordan OECD average Uruguay Israel Thailand Luxembourg Portugal Hungary Austria Brazil Mexico Albania Trinidad and Tobago Shanghai-China Sweden ... Estonia Lithuania Azerbaijan Iceland Norway Finland Sweden Dubai (UAE) Peru Mexico Korea Argentina Indonesia Turkey Colombia Chinese Taipei Qatar Panama Italy Australia Chile Japan Israel Uruguay Albania ... Albania Shanghai-China New Zealand Jordan Singapore Tunisia Greece Thailand Portugal Brazil Macao-China OECD average Spain Trinidad and Tobago Belgium Kyrgyzstan Ireland United States Canada Montenegro...
  • 106
  • 536
  • 0
Tài liệu Báo cáo khoa học: Membrane targeting and pore formation by the type III secretion system translocon pdf

Tài liệu Báo cáo khoa học: Membrane targeting and pore formation by the type III secretion system translocon pdf

Báo cáo khoa học

... to interact with the membrane-associated ATPase located at the base of the T3SS (shown in orange in Fig 1) The T3SS ATPase is similar to the F1 ATPases [37] and associates into a hexameric ring, ... thus facilitating fusion of exocytic vesicles with the plasma membrane and increasing Salmonella invasion efficiency [62] It is of note that both IpaC and SipC are essential for Shigella and Salmonella ... Salmonella uptake by macrophages in the early steps of invasion, and have the ability to induce membrane extensions (filopodia and lamellipodia) on macrophages [55,63] Specifically, IpaC was shown...
  • 13
  • 647
  • 0
Tài liệu Báo cáo khoa học: High-affinity ligand binding by wild-type/mutant heteromeric complexes of the mannose pptx

Tài liệu Báo cáo khoa học: High-affinity ligand binding by wild-type/mutant heteromeric complexes of the mannose pptx

Báo cáo khoa học

... binding The data were graphed and analyzed using graphpad prismÔ (Graphpad Software, San Diego, CA, USA) Ligand binding parameters were measured by competitive binding analysis Equal amounts of the ... epitope tag (HA instead of Myc) was combined with the FLAG epitope tag 30 µg 1-15F cDNA µg 1-15F R 2A cDNA 30 Fig Schematic diagram and ligand binding analysis of soluble 1-15 and 1-15R 2A mutant FLAG ... indicate the amounts of the various cDNAs transfected into cells for each condition and apply to the data shown both above and below the table Values represent the mean ± SD of three replicate measurements...
  • 15
  • 486
  • 0
Sentinel Event Data Root Causes by Event Type 2004-2012 doc

Sentinel Event Data Root Causes by Event Type 2004-2012 doc

Tổ chức sự kiện

... voluntary and represents only a small proportion of actual events Therefore, these root cause data are not an epidemiologic data set and no conclusions should be drawn about the actual relative ... voluntary and represents only a small proportion of actual events Therefore, these root cause data are not an epidemiologic data set and no conclusions should be drawn about the actual relative ... voluntary and represents only a small proportion of actual events Therefore, these root cause data are not an epidemiologic data set and no conclusions should be drawn about the actual relative...
  • 29
  • 2,647
  • 0
International lung cancer trends by histologic type: male:female differences diminishing and adenocarcinoma rates rising pot

International lung cancer trends by histologic type: male:female differences diminishing and adenocarcinoma rates rising pot

Sức khỏe giới tính

... U.S blacks and whites, Canada, Australia, Denmark, Sweden, Italy and the Netherlands (Fig 2a) Rates changed less dramatically in many other areas and rose substantially only in Spain, where the ... Canada and Iceland, after being around in the early years in North America, Australia, Denmark and Norway, and exceeding 10 in the Netherlands, Italy, France and Spain In contrast to the generally ... squamous and small cell carcinoma rates among males, adenocarcinoma rates rose in virtually all areas, with the increases exceeding 50% in Norway, Iceland, the Netherlands, Italy, France and Spain...
  • 6
  • 349
  • 0
Báo cáo khoa học: Direct detection of stereospecific soman hydrolysis by wild-type human serum paraoxonase potx

Báo cáo khoa học: Direct detection of stereospecific soman hydrolysis by wild-type human serum paraoxonase potx

Báo cáo khoa học

... for all four of the substrates is shown below: TA ¼ A0 =VmaxA Þð1 À A= A0 ÞðKmA =KmA ÞðVmaxA =VmaxA ÞÞ GC ⁄ MS analysis GC separation of the GD stereoisomers was performed using a modification of ... ðC0 =VmaxC Þð1 À A= A0 ÞðKmA =KmC ÞðVmaxC =VmaxA ÞÞ þ ðD0 =VmaxD Þð1 À A= A0 ÞðKmA =KmD ÞðVmaxD =VmaxA ÞÞ ðKmA =VmaxA Þ LogE A= A0 Þ TB ¼ A0 =VmaxA Þð1 À ðB=B0 ÞðKmB =KmA ÞðVmaxA =VmaxB ÞÞ þ ... Reconsideration of the catalytic center and mechanism of mammalian paraoxonase ⁄ arylesterase Proc Natl Acad Sci USA 92, 7187–7191 33 Rodrigo L, Mackness B, Durrington PN, Hernandez A & Mackness...
  • 9
  • 272
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Quality of Life as reported by school children and their parents: a cross-sectional survey" docx

Điện - Điện tử

... interpretation of data and the revision of the manuscript FM is the original author of the ILC, and made a contribution to the translation process of the Norwegian ILC, statistical analysis and the ... of the manuscript URS is the original author of the KINDL, and made a contribution to the translation process of the Norwegian KINDL, statistical analysis and the revision of the manuscript All ... = "Often" and = "Always") Mean scores are calculated for each of the six subscales and for the total scale and linearly transformed to a – 100 scale In school populations, the German ILC has...
  • 11
  • 567
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt

Hóa học - Dầu khí

... AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA UUGUCUCAA(UCA) AGCAGUAGCAAGGAGAUUUUUGAAUUAUAUAUAGCAAUACAACAGUUGAUCAUAAAAUGUGCGAUGAAUUUAAUC UGACUUUAAUUUUCUCCAGGAAUGUUG(CUA) ... AGCAGGAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGUAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUU AACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA PB2 PB2/6U PB2/85 PB2/34 ... a in 5' end non coding sequencea AGCAGUAGCAAGAGGAUUU(UUA) AGCAGUAGCAAGAGGAUUUUUUCAUUUAAUGGAAUAACAAAAAUAUGUGCAAGUAGGAGGAAAGGGUUUAACAG CCCCUCC(UCA) AGCAGUAGCAAGGGGAUUUUUUCUUAUAAUGA(UCA) AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA...
  • 11
  • 427
  • 0
Chapter 10:Criteria and Test Types doc

Chapter 10: Criteria and Test Types doc

Anh ngữ phổ thông

... (language skills, areas included…)   Construct validity A test having construct validity is capable of measuring specific characteristics in accordance with a theory of language behavior and ... criteria for evaluating any test ( an ideal test should be valid & reliable)  The greater the reliability of a test, the less validity it usually has  Discrimination An important feature of a test ... of marker reliability)  Reliability (measuring methods) (1) (2) Re-administering the same test (the same group of candidates) after a lapse time Administering parallel forms of the test to the...
  • 24
  • 477
  • 1
 Báo cáo y học:

Báo cáo y học: "The association of meat intake and the risk of type 2 diabetes may be modified by body weight"

Y học thưởng thức

... or cardiovascular disease between the baseline and follow-up FFQs, only dietary data from the baseline FFQ were included in this analysis For other participants the average of the baseline and ... and the large study size allowed us to examine the effect of BMI and meat intake in detail Misclassification of dietary assessment would most likely be non-differential and would have attenuated ... have examined the association between meat consumption and the risk of type DM Total meat was associated with a higher prevalence of diabetes in the Seventh Day Adventist Study conducted in California...
  • 8
  • 701
  • 0
AN INVESTIGATION INTO VOCABULARY LEARNING STRATEGIES EMPLOYED BY STUDENTS AT HUNG VUONG GIFTED HIGH SCHOOL

AN INVESTIGATION INTO VOCABULARY LEARNING STRATEGIES EMPLOYED BY STUDENTS AT HUNG VUONG GIFTED HIGH SCHOOL

Khoa học xã hội

... Post Graduate Department and the lecturers at College of Foreign Languages, Vietnam National University-Hanoi for their valuable lectures, which laid the foundation of this thesis and for their ... vocabulary learning strategy by gender and major in relation to strategy use A vocabulary learning strategy questionnaire was used for data collection Statistical analysis revealed that most of ... knowledge as well as their sympathy I am thankful to Ms Nguyen Thi Thuy Minh, the lecturer at Post Graduate Department, College of Foreign Languages, Vietnam National University-Hanoi and Ms Tran Thi...
  • 6
  • 1,368
  • 32
ENGLISH ADVERBS OF MANNER AND TYPICAL ERRORS MADE BY THE STUDENTS AT LE HONG PHONG SPECIALISED SECONDARY SCHOOL, NAM DINH CITY

ENGLISH ADVERBS OF MANNER AND TYPICAL ERRORS MADE BY THE STUDENTS AT LE HONG PHONG SPECIALISED SECONDARY SCHOOL, NAM DINH CITY

Khoa học xã hội

... than one kind of adverb in a sentence ( adverb of manner, adverb of place and adverb of time), adverb of manner precedes adverb of place and adverb of time So the order of these adverbs is as ... or a subjunct in the clause * Adverb of manner as an adjunct As an adjunct, the manner adverb can be integrated into the structure of a clause So the manner adjunct is similar in the weight and ... teacher was given on vocabulary or any other things of the test Forty minutes later, all the papers were then gathered by the leader of the class and given to the teacher as the researcher After...
  • 55
  • 1,084
  • 8
An analysis of english reported speech errors made by high school students in nam dan district = phân tích lỗi lời nói gián tiếp trong tiếng anh của học sinh THPT ở huyện nam đàn luận văn thạc sĩ giáo dục học

An analysis of english reported speech errors made by high school students in nam dan district = phân tích lỗi lời nói gián tiếp trong tiếng anh của học sinh THPT ở huyện nam đàn luận văn thạc sĩ giáo dục học

Khoa học xã hội

... vocabulary and even the grammatical rules of the learners’ first language into the second language In contrastive analysis, it is believed that the type of errors made by the learners of the target ... handed in, they are carefully read and all the types are identified, calculated and classified on the basis of error classifications presented in chapter II All the errors found are then analyzed ... what they have learnt An example is the generalization of the relative pronoun that as in: Anna, *that had a great sense of unconventional morality… The learners use that to the exclusion of who...
  • 88
  • 1,149
  • 4
An analysis of errors commonly committed by high school students in using english questions

An analysis of errors commonly committed by high school students in using english questions

Khoa học xã hội

... regarded as the result of similarities between the first and the second language due to the fact that habits used in the first language are easily transferred to the second one On the other hand, ... that, the lesson should be carried out in the way that the content is interesting and relevant to learners’ age and level of ability, the learning goals are challenging yet manageable and clear ... some of the general characteristics of language acquisition And the details, intralingual errors are those that reflect the general characteristics of rule learning, such as faulty generalization,...
  • 117
  • 828
  • 4
An analysis of errors made by high school student in the use of subject verb agreement in english writing = phân tích lỗi sai của học sinh PTTH về sự tương hợp giữa chủ ngữ và động từ trong văn viết tiếng anh

An analysis of errors made by high school student in the use of subject verb agreement in english writing = phân tích lỗi sai của học sinh PTTH về sự tương hợp giữa chủ ngữ và động từ trong văn viết tiếng anh

Khoa học xã hội

... language as a means of organising the L2 They "tend to transfer the form, meanings and the distribution of forms and meaning of their native language and culture to the foreign language and culture" ... in extra English classes It can be said that at their level, they have already had an amount of vocabulary and grammar to carry out many types of learning activities Especially, they are provided ... beer and food" With the appearance of "and" , they mistook "The Bat and the Ball" for a plural subject, which leads to their wrong usage of the plural verb In fact, there are some exceptions "The...
  • 47
  • 1,375
  • 9
An analysis of errors made by vietnamese secondary school students in using english modal auxiliary verbs can, could, may, must and semi   auxiliary verb have to

An analysis of errors made by vietnamese secondary school students in using english modal auxiliary verbs can, could, may, must and semi auxiliary verb have to

Khoa học xã hội

... description and analysis of students' errors play an important role in the improvement of the teaching and learning Error analysis has been an interesting area, which has attracted the attention of an ... understanding of language competence Meanwhile mistakes are caused by the inappropriate use of language in the term of social acceptability or language performance 1.5.3 Error analysis Error analysis ... Lado given individuals tend to transfer the form, meanings, and the distribution of forms and meanings of their native language and culture to the foreign language and culture (Lado 1957: 2) and...
  • 51
  • 755
  • 0
An error analysis of using reference in written english by secondary   school studend = phân tích lỗi của học sinh THPT tong việc sử dụng phép quy chiếu trong tiếng anh viết

An error analysis of using reference in written english by secondary school studend = phân tích lỗi của học sinh THPT tong việc sử dụng phép quy chiếu trong tiếng anh viết

Khoa học xã hội

... (1976), Halliday and Hasan show that that is always anaphoric, this may be either anaphoric or cataphoric.In addition, the demonstratives this and that may refer to a clause, a sentence and a sequence ... we saw yesterday It is a similar cat to the one we saw yesterday (Halliday and Hasan, 1976:78) (2) Particular comparison Halliday and Hasan (1976) show that particular comparison means comparison ... similar In fact, these items are semantically similar but their uses are different Halliday and Hasan (1976) and Munz and Pyle (1994) can help by offering the uses of the three above comparative...
  • 51
  • 613
  • 0
Luận văn ellipsis in english an analysis of errors made by secondary school students = phân tích lỗi thường gặp của học sinh THPT trong việc sử dụng phép tỉnh lược trong tiếng anh

Luận văn ellipsis in english an analysis of errors made by secondary school students = phân tích lỗi thường gặp của học sinh THPT trong việc sử dụng phép tỉnh lược trong tiếng anh

Khoa học xã hội

... there is a choice between the realized items in the first clause or in the last Joan will cook the meals today and Barbara may cook the meals today Joan will cook the meals today and Barbara ... is an example of a presentation of a typical ellipsis within sentence: Joan will cook the meals today and Barbara may cook the meals tomorrow Joan will cook the meals today and Barbara may tomorrow ... interlingual as they resulted from language transfer; and they are intralingual as the result of inadequate knowledge and faulty use of different items of the target language chapter III: findings and...
  • 57
  • 752
  • 2

Xem thêm

Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008